Лада 2019: новые модели и успехи Бренда

Содержание

Lada Vesta Sport 2019 обзор, комплектации и цены, характеристики

Обзор Vesta Sport

LADA Vesta Sport.


Твой драйв. Твои правила

LADA Vesta Sport – автомобиль, построенный с применением гоночных технологий и адаптированный к ежедневным поездкам по городу и шоссе. LADA Vesta Sport – это особый яркий стиль, полностью перенастроенное шасси и мотор, форсированный до 145 л.с.

Удовольствие энергичного вождения

LADA Vesta


Совершенство – в графике и характере

LADA Vesta Sport заряжена не только конструктивно, но и визуально – благодаря специальному аэродинамическому обвесу, который формирует эксклюзивный стиль автомобиля. Спойлер на багажнике снижает подъемную силу и подчеркивает стремительный силуэт. Традиционный для гонок красный цвет применен и в деталях кузова, и в отделке салона: яркой нитью прострочена кожаная обшивка рулевого колеса, в красный цвет окрашены шкалы комбинации приборов.

Мультимедийная система

Мультимедийная система с 7-дюймовым экраном – это любимая музыка, новости по радио, телефонная связь hands free. Все, что нужно, чтобы поездка проходила быстрей и приятней! А навигатор сделает путешествие не только быстрее, но и проще, эффективней. На экран мультимедиа выводится изображение с камеры заднего вида – вместе с парктроником это обеспечивает уверенное маневрирование в тесноте городов.

Высокий уровень защиты

У LADA Vesta Sport — специальная тормозная система, разработанная, чтобы автомобиль со спортивным характером мог уверенно замедляться с высоких скоростей. Увеличен диаметр переднего тормозного диска, снижена температурная нагрузка на диск, увеличены передние тормозные колодки и передние тормозные поршни. Система контроля устойчивости ESC обладает особыми настройками, сочетающими азарт и безопасность вождения..

Двигатель

Форсированный мотор LADA Vesta Sport объемом 1,8 л. получил перенастроенную систему регулировки фаз газораспределения, оригинальные распредвалы, спортивные калибровки контроллера и модернизированную систему впуска и выпуска. А специальные настройки шасси обеспечивают максимальное пятно контакта с дорогой, снижают крены кузова, обеспечивают четкую реакцию на поворот рулевого колеса.

Рабочий объем 1774 см
Мощность 145 л.с. (106,6 кВт) при 6000 об/мин
Момент крутящий 184 Нм при 3600 об/мин
Нормы токсичности ЕВРО-5

Любая модель LADA Vesta теперь может стать еще более яркой, контрастной и стильной. Достаточно заказать опционное покрытие крыши и наружных зеркал в черном глянцевом цвете. Какое сочетание смотрится лучше? Черный и красный? Черный и синий? А может, черный и оранжевый? Выбирать вам! Черная крыша применяется совместно со всей палитрой эмалей LADA Vesta, исключая «Маэстро» и «Фантом».

Фотографии

Фотогалерея Vesta Sport

Компактный седан Vesta приобрел новый смысл в серии LADA Vesta Sport, вышедшей в конце 2018 года.

Кузов стал более заниженным, обретя клиренс 145 мм. Концепции и линии сохранились, но приобрели более плавные очертания. В частности, изменилось строение колесных арок и переднего бампера. Шасси от Веста сохранило конструкцию, но получило новые настройки. К началу продаж этот седан обещает стать самым популярным аналогом бюджетных автомобилей со спортивными амбициями.

Экстерьер нового Лада Веста Спорт объединяет аэродинамические черты с удобными для городского передвижения. Впервые производитель применяет в оптике функцию дублирования поворотов, задействовав противотуманные фары. Колеса имеют надежное крепление с помощью пяти шпилек, что упрощает замену резины или смену колеса при аварии.

Салон Vesta Sport будет иметь отличия, в зависимости от цены комплектации, но общие черты известны уже сейчас. Например, отчетливо выделяющаяся боковая поддержка сидений впереди. А также функциональное рулевое колесо и удобно скомпонованная панель элементов для быстрого переключения. В базовый пакет войдут основные системы поддержки и стабилизации, фронтальные подушки безопасности, комплекс поддержки и навигации с сенсорным экраном. Опционально будут предложены климат-контроль, датчики дождя и света, камера-парктроник и подогрев сидений.

Тормозная система нового Веста Спорт получила новые дисковые тормоза передних колес. Рев 145-сильного мотора согревает сердце на высоких оборотах, а на низких автоматически стихает. За это отвечает новая выхлопная система с функцией шумоподавления. В целом, купить этот автомобиль стоит свеч, ведь производитель создает его почти с нуля, из 205 сертифицированных и проверенных деталей.

Руководства по эксплуатации

 Руководство по эксплуатации LADA Vesta от 29.10.20

 Руководство по эксплуатации LADA Vesta от 27.08.20

 Руководство по эксплуатации LADA Vesta от 07.07.20

 Руководство по эксплуатации LADA Vesta от 25.03.20

 Руководство по эксплуатации LADA Vesta от 26.02.20

 Дополнение к руководству по эксплуатации LADA Vesta CNG от 26.02.20

 Руководство по эксплуатации LADA Vesta от 31.01.20

 Руководство по эксплуатации LADA Vesta от 15.11.19

 Дополнение к руководству по эксплуатации LADA Vesta CNG от 04.06.19

 Мультимедийная система LADA Vesta от 04.06.19

 Руководство по эксплуатации LADA Vesta от 04.06.19

 Руководство по эксплуатации LADA Vesta от 28.02.19

 Руководство по эксплуатации LADA Vesta от 11.01.19

 Руководство по эксплуатации LADA Vesta от 21.11.18

 Дополнение к руководству по эксплуатации LADA Vesta Sport от 01.10.18

 Руководство по эксплуатации LADA Vesta от 31.08.18

 Руководство по эксплуатации LADA Vesta от 20.06.18

 Руководство по эксплуатации LADA Vesta от 06.02.18

 Руководство по эксплуатации LADA Vesta от 21.12.17

 Руководство по эксплуатации LADA Vesta от 04.10.17

 Руководство по эксплуатации LADA Vesta от 21.08.17

 Дополнение к руководству по эксплуатации LADA Vesta CNG от 23.06.17

 Руководство по эксплуатации LADA Vesta от 05.06.17

 Мультимедийная система LADA Vesta от 31.05.17

 Руководство по эксплуатации LADA Vesta от 28.04.17

 Руководство по эксплуатации LADA Vesta от 17.03.17

 Руководство по эксплуатации LADA Vesta от 01.03.17

 Мультимедийная система LADA Vesta от 13.01.17

 Руководство по эксплуатации LADA Vesta от 23.12.16

 Мультимедийная система LADA Vesta от 20.10.16

 Руководство по эксплуатации LADA Vesta от 09.09.16

 Руководство по эксплуатации LADA Vesta от 14.07.16

 Руководство по эксплуатации LADA Vesta от 21.06.16

 Руководство по эксплуатации LADA Vesta от 20.04.16

 Руководство по эксплуатации LADA Vesta от 25.02.16

 Мультимедийная система LADA Vesta от 01.02.16

 Руководство по эксплуатации LADA Vesta от 29.01.16

  Руководство по эксплуатации LADA Vesta от 24.11.15

  Мультимедийная система LADA Vesta от 04.11.15

Купить Лада Веста Спорт в Москве

На сайте официального дилера Major Lada вы можете купить Лада Веста Спорт в Москве по выгодной цене. Для уточнения комплектаций Lada Vesta Sport и технических характеристик, закажите обратный звонок.

Каких LADA в России больше

Каких LADA в России больше Аналитики российского авторынка провели исследование, в котором выяснили самые востребованные модели отечественного автогиганта АВТОВАЗ.
Результаты оказались весьма неожиданными.

Всего на данный момент российские автолюбители владеют 13,47 млн машин линейки LADA.

Несмотря на высокую популярность моделей Granta и Vesta, эти автомобили не вошли в ТОП-5 самых востребованных.

На первой строчке рейтинга оказалась «семерка» — LADA 2107. На эту модель приходится 1,68 млн авто.
Номер два в рейтинге — LADA 2109 (1,44 млн экз.). Третью строчку заняла LADA 2106 (1,32 млн авто).
Четвертое по популярности место заняла народная «Нива» 2121 с результатом в 973 500 экз.
ТОП-5 самых популярных моделей АВТОВАЗа замыкает «десятка» — LADA 2110 (844 100 экз.).

Также в список популярных моделей вошли: Lada 2114 (812 700 экз.), 2105 (650 400 экз.), Lada Granta (633 400 экз.), 2115 (590 500 экз.), а также «четверка» 2104 (530 000 экз.).

Отправляя сообщение, я выражаю свое согласие и разрешаю ПАО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

Отправляя сообщение, я выражаю свое согласие и разрешаю ПАО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

Отправляя сообщение, я выражаю свое согласие и разрешаю ПАО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

LADA с семейством Granta – лидер авторынка РФ в 2019 году

Подведены итоги продаж в России в 21019-м году новых легковых авто. Соответственно названы марки и модели машин, которые в прошлом году были самыми раскупаемыми. Лидерами вновь стали марка ЛАДА и модель Лада Гранта.

Самые продаваемые в 2019-м году в РФ марки и модели машин перечислены в новом отчете от Ассоциации европейского бизнеса (АЕБ). Из документа становится ясно, что в России за прошлый год новые авто были раскуплены в количестве 1 миллиона 759 тысяч 532 штук. По сравнению с результатом продаж годичной давности это оказалось ниже на 2,28%.

Бессменным лидером авторынка РФ в 2019-м году остался АВТОВАЗ с маркой ЛАДА. Россияне за прошлый год купили 362 тысячи 356 авто данного российского автопроизводителя. За год объем продаж LADA вырос на 1%. При этом марка смогла на рынке занять долю в 20,6%. Это на 0,6 п.п. превышает показатели за 2018-й год. Помимо LADA в прошлом году россияне часто покупали машины марки КИА (225 тыс. 901 ед.) и Рено (114 тыс. 989 ед.).

Титул самого продаваемого в 2019-м году в РФ авто вновь получила LADA Granta. Эта модель такое же звание получала по итогам продаж в 2013-м, 2014-м и 2015-м годах. В 2019-м году Гранта разошлась в количестве 135 тыс. 831 штуки. Второй по популярности LADA и второй самой востребованной в РФ в 2019-м году моделью оказалась Лада Веста. Покупателями этой модели в отчетный период стали 111 тыс. 459 россиян. Замыкает тройку лидеров российского авторынка в 2019-м году иномарка – КИА Рио. Ее продажи составили 92 тысячи 475 единиц.

ТОП-25 бестселлеров 2019-го года на первичном авторынке РФ включает еще несколько моделей с шильдиком LADA. Универсалы Лада Ларгус, купить которые в прошлом году предпочли 43 тысячи 123 покупателя, заняли в рейтинге седьмую позицию. С результатом в 31 тысячу 923 проданных авто внедорожник ЛАДА 4х4 смог занять 14-е место. Купить кроссовер Лада Икс Рей в 2019-м году предпочли 285 тыс. 967 россиян. Благодаря этому модель удержалась в списке самых продаваемых в РФ машин и разместилась на 17-й позиции в соответствующем списке.

Заемщики на Lada дышат – Газета Коммерсантъ № 220 (6700) от 29.11.2019

Как узнал “Ъ”, чаще всего задерживают платежи по автозалогам владельцы Lada Granta — бестселлера российского рынка автомобилей. Также высок процент просрочки у владельцев некогда популярной Opel Astra, которая не продается в РФ с 2015 года. Среди других самых массовых в автозаймах машин наиболее пунктуально вносят платежи по залогу владельцы Nissan Almera, Mitsubishi Outlander и Toyota Corolla.

Чаще прочих платежи по автозалогам задерживают владельцы Lada Granta, следует из исследования сервиса автозайма CarMoney (работает в 68 регионах, более 12 тыс. активных клиентов). Процент просрочки по таким залогам составляет 43%. В выборку попали заемщики, которые с начала 2019 года хотя бы раз задержали платежи.

Им чуть уступают владельцы Opel Astra, процент просрочки по которой достигает 41%, а также Hyundai Accent (40%). Напомним, Opel свернул производство в РФ в 2015 году, но в 2017 году PSA купила бренд у GM и в 2019 году объявила о его возвращении в РФ. По Renault Logan, который много лет остается в топ-25 самых продаваемых моделей российского авторынка, платежи задерживают также 40% владельцев. В прошлом году среди лидеров по просрочкам были собственники Ford Focus, Toyota Camry, Chevrolet Cruze и Hyundai Solaris.

Сейчас некогда популярный на авторынке Focus оказался в середине рейтинга — его владельцы задерживают 34% платежей. Чуть выше процент задержек по Toyota Camry — 35%. Улучшили показатели и владельцы Hyundai Solaris (32% просрочки), на том же уровне просрочка и Kia Rio (32%). При этом владельцы Chevrolet Cruze остаются среди тех, кто наиболее часто задерживает платежи (38%).

Реже всего просрочку допускают собственники Nissan Almera (23%). Чуть хуже статистика у Mitsubishi Outlander (26%) и Toyota Corolla (29%).

Владельцы модели Outlander были среди самых ответственных заемщиков и в 2018 году, подсчитали в CarMoney. Также положительный результат в прошлом году показывала Niva Chevrolet.

По данным Ассоциации европейского бизнеса, Lada Granta — бестселлер российского рынка легковых автомобилей в январе—октябре (продано почти 108,7 тыс. машин). При этом Kia Rio остается лидером продаж среди иномарок (почти 78,1 тыс. машин). Hyundai Solaris занимает пятую строчку в топ-25 самых продаваемых моделей с результатом в 49,8 тыс. проданных автомобилей, Renault Logan — 11-ю строчку (почти 28,5 тыс. машин). Camry — самая продаваемая в РФ модель японского концерна Toyota (продано 27,7 тыс. машин). Mitsubishi Outlander — единственная модель концерна в топ-25 бестселлеров и занимает 22-ю строчку с результатом в 19,5 тыс. машин.

Владимир Беспалов из «ВТБ Капитала» отмечает, что Lada Granta, по которой самый высокий процент просрочки, с одной стороны, бестселлер рынка, а с другой — бюджетный автомобиль, и его покупателям может быть тяжелее обслуживать залог. В сегмент бюджетных машин, вероятно, попадает и Opel Astra, поскольку модель давно ушла с рынка новых, говорит он. При этом по Toyota Camry тенденция не такая определенная, поскольку это премиальный автомобиль. Но аналитик отмечает, что таких автомобилей продается достаточно много и для некоторых клиентов данная модель — шанс купить машину «получше и подороже», который может не всегда соответствовать реальным финансовым возможностям.

Ольга Никитина

В Казахстане развалился крупнейший автохолдинг «БИПЭК Авто»

Правоохранительные органы Казахстана объявили в розыск по обвинению в мошенничестве владельца крупнейшей казахстанской сети дилеров «БИПЭК Авто» Анатолия Балушкина еще в начале осени.

Аналогичное требование о задержании бизнесмена пришло и в российское МВД, однако Генпрокуратура РФ вынесла отказ в задержании мужчины, пишет «Русский автомобиль» со ссылкой на соответствующее письмо надзорного ведомства.

«Разъясняю, в связи с тем, что вы являетесь гражданином Российской Федерации, Генеральной прокуратурой РФ направлено соответствующее поручение ФКУ «ГИАЦ МВД России» о прекращении в отношении вас розыска на территории РФ», — приводит сообщество ответ надзорного ведомства в письме Балушкину.

Проблемы у бизнесмена Анатолия Балушкина начались ровно два года назад,

когда Министерство индустрии и инфраструктурного развития (МИИР РК) Казахстана разорвало контракт на промышленную сборку автомобилей с заводом «Азия Авто». Последний входит в автомобильную группу «БИПЭК Авто» Балушкина — в партнерстве с «АвтоВАЗом» он производил автомобили Lada на территории Казахстана c 2004 года.

Российский автогигант имеет в усть-каменогорском предприятии блокирующий пакет (25% + 1 акция). Первоначально в Казахстане производился внедорожник Lada 4×4 («Нива»), а в 2016 году производственные мощности «Азия Авто» расширились и на его конвейер встала вся остальная продукция «АвтоВАЗа». Фактически это был первый в истории независимого Казахстана автомобильный завод.

«БИПЭК» утрачен

В конце 2019 года чиновники МИИР пришли к выводу, что руководство завода не выполнило перед республикой обязательства по углублению процессов производства (локализации). А именно не создало требуемые в рамках соглашения цеха сварки и окраски кузовов.

Это не позволило перевести производство «Азия Авто» из статуса «отверточного» крупноузлового в разряд CKD (мелкоузловая сборка).

В обмен на обязательства по локализации предприятию предоставлялись промсубсидии и обнулялись таможенные пошлины для ввоза машинокомплектов.

Недостачу бюджета чиновники оценили в 174 млрд тенге (около $412 млн).

Состояние самого Анатолия Балушкина казахстанский Forbes оценивал в 2019 году в $153 млн (35-е место). Входящая в его бизнес-империю компания «БИПЭК Авто» образует самую обширную в Казахстане дилерскую сеть. До 2018 года через нее продавалось больше трети новых автомобилей на казахстанском рынке. В прошлом году доля «БИПЭКа» на местном рынке составляла около 25%. Однако сейчас ситуация складывается катастрофическим образом для некогда ведущего игрока рынка.

«Салоны дилерской сети «БИПЭК Авто» закрылись еще в I квартале нынешнего года, собственно, с этого момента холдинг фактически прекратил свое присутствие на рынке.

В этом смысле последние следственные мероприятия никак не изменят рыночное положение группы компаний», – рассказал о текущей ситуации корреспонденту «Газеты.Ru» заместитель председателя правления ассоциации «КазАвтоПром» (объединяет предприятия автопрома РК) Артур Мискарян.

Портфель брендов-партнеров усть-каменогорского холдинга, за исключением Skoda, по большей части перешел на кустанайскую площадку «СарыаркаАвтоПром», отмечает собеседник. Закрытие завода «Азия Авто» негативно сказалось на рынке: выросли цены, отсутствуют бюджетные модели на складах у дилеров, рассказал зампред правления «КазАвтоПрома».

«Предсказуемым образом эта ситуация сказывается и на налоговых поступлениях автопрома. Не говоря о проблеме трудоустройства для всего коллектива холдинга», — заметил Мискарян.

Казахстан заберет бизнес

У опального казахстанского бизнесмена есть автомобильные активы и в России. В 2016-2017 годах «АвтоВАЗ» в рамках партнерства передал казахской стороне собственные дилерские сети в Восточной Сибири. Впрочем, Анатолию Балушкину вряд ли удастся с этим бизнесом достичь хоть сколько-нибудь сопоставимых объемов продаж в сравнении с дистрибуцией машин в Казахстане, убежден независимый консультант по автопрому Сергей Бургазлиев.

Он указывает на то, что

российский рынок уже поделен между основными игроками, вырасти здесь можно только за счет приобретения какого-то другого участника.

Для российских партнеров, в частности для АвтоВАЗа, закрытие «Азия Авто» фактически ознаменовало потерю крупнейшего (после Украины, некогда бывшей направлением №1) экспортного рынка, отмечает Артур Мискарян из «КазАвтоПрома». Перспективы завода зависят от конечных итогов следствия, считает он.

Если владельцу «БИПЭК Авто» не удастся найти компромисс со следствием и доказать свою невиновность, то власти смогут взыскать его имущество и в России, уверен Бургазлиев. Таким образом, дилерские центры «АвтоВАЗа» в Восточной Сибири могут перейти в собственность к правительству Казахстана.

«Нужно изучать законодательство, смотреть документы союзного государства, но если суд решится не в пользу бизнесмена, то иски обратятся и на его имущество в РФ», — заметил Бургазлиев.

В пресс-службе «АвтоВАЗа» обстоятельства взаимосвязей с экс-партнером Анатолием Балушкиным комментировать отказались. Вопросы о дилерских центах переадресовали их собственникам. «Газета.Ru» направила вопросы на личную электронную почту Анатолия Балушкина о видении ситуации вокруг его активов в Казахстане. На момент публикации материала ответ не поступил.

Оперативные комментарии относительно причин уголовного преследования бизнесмена «Газете.Ru» также не предоставили Генпрокуратуры РФ и РК, а также МИИР.

Итоги 4 этапа LADA Sport ROSNEFT eChampionship.

На виртуальной версии подмосковной трассы Moscow Raceway состоялась гонка четвертого этапа киберчемпионата LADA Sport ROSNEFT eChampionship, который организован при поддержке нефтегазовой компании «Роснефть». Завершилась она убедительной победой Кирилла Антонова. 

Пилот команды LADA Sport ROSNEFT eRacing Team собрал «Большой шлем» став лучшим и в квалификации, и в самой гонке, а также установив лучшее время круга в гоночном режиме.

Вечер для пилота команды LADA Sport ROSNEFT eRacing Team начался с победы в квалификации – второй подряд после этапа в Японии. Заезд проходил в идеальных погодных условиях, что позволяло пилотом показать максимум своих возможностей в борьбе за лидерство на стартовой решетке.

Кирилл Антонов по итогам квалификации смог на двенадцать сотых секунды опередить LADA Vesta Sport TCR под управлением Адама Пинца из команды Arnege Competition, что обеспечило россиянину первое место на старте гонки. Результаты сессии оказались настолько плотными, что в полусекунде от лидера разместилось сразу 9 пилотов.

Кирилл Антонов и Адам Пинц сохранили две первые позиции на старте и начали отрываться от соперников. Венгр на пару кругов опустился в хвост первой десятки после обязательного пит-стопа, но уже к 15-му кругу вернул себе второе место, в то время как пилот LADA Sport ROSNEFT eRacing Team сохранял лидерство по ходу всех 28 кругов и одержал третью победу в сезоне, еще более укрепив позиции в общем зачете чемпионата. 

Напарник по тольяттинской команде Павел Муконин, стартовавший четвертым, составил Антонову и Пинцу компанию на подиуме.

Топ-5 пилотов по итогам финиша:

Кирилл Антонов (Россия, LADA Sport ROSNEFT eRacing Team) – 46:38.530

Адам Пинц (Венгрия, Arnage Competition) — +07.663

Павел Муконин (Россия, LADA Sport ROSNEFT eRacing Team) — +19.106

Флориан Хассе (Германия, Dorr Esports) — +20.564

Алессандро Оттавиани (Италия, Virtualdrivers By TX3) — +20.745

Кирилл Антонов, победитель гонки 4 этапа:

«Гонка получилось более чем активной, несмотря на то, что ехал я большую часть заезда в одиночку. Моей основной задачей было сохранить резину и заставить соперников нервничать: в других чемпионатах я изучил их и понимаю, где могут быть их слабости. Я смог реализовать свою задачу полностью. Провел отличный пит-стоп и проехал со стабильным темпом до финиша. Спасибо команде за тренировки и за бесценный опыт реальных заездов, дальше будем стараться ещё сильнее, чтобы добиваться ещё больших успехов!».

Чемпионат продолжается! 4 октября стартует отборочная часть пятого этапа, финальная гонка стадии состоится 20 октября на итальянской трассе IMOLA. Как и прежде, все участники будут стартовать на виртуальной копии автомобиля LADA Vesta Sport TCR класса «Туринг». 

Подробности на официальной странице чемпионата.

Календарь киберчемпионата LADA Sport ROSNEFT eChampionship 2021:

5 этап. Отборочный этап — 04-17 октября, гонка — 20 октября. Трасса Imola

6 этап. Отборочный этап — 01-14 ноября, гонка — 17 ноября. Трасса Hokkenheimring

Гранд-финал – декабрь.

Расширенная нормализация FRET позволяет проводить количественный анализ белковых взаимодействий, включая стехиометрию и относительную аффинность в живых клетках.

Используемые плазмиды

Все плазмиды, которые мы использовали, доступны из коллекции лаборатории Шмида. Банк данных, содержащий их, доступен в Интернете по адресу http://www.meduniwien.ac.at/user/johannes.schmid/. Используемые плазмиды и карты перечислены на дополнительном рисунке 11.

Подготовка образцов клеток

Все эксперименты проводились на клетках HeLa, клон ACC 57.Клетки пассировали за день до трансфекции, достигая слияния 70-80% в день трансфекции. Для экспериментов под микроскопом клетки высевали на 8-луночные предметные стекла там же с стеклянным дном. Для проточной цитометрии клетки высевали в 24-луночные многолуночные планшеты. Для достижения охвата в широком диапазоне соотношений акцептора к донору плазмиды, несущие донор или акцептор, трансфицировали в пяти различных массовых соотношениях: 5: 1, 3: 1, 1: 1, 1: 3 и 1: 5. Трансфекция была достигнута с помощью реагента для трансфекции TurboFect ™ (Thermo Scientific ™, номер по каталогу: R0531) в соответствии со спецификациями продукта.

Получение и оценка микроскопических изображений

Микроскопия проводилась на конфокальной системе лазерного сканирования Nikon A1 R +, оснащенной 12-битными детекторами, с использованием апохроматического масляного иммерсионного объектива 60x (NA1.4). Донорный канал был получен при возбуждении на 488 нм и эмиссионном фильтре 525/50. Канал FRET был получен при возбуждении на 488 нм и эмиссионном фильтре 595/50. Акцепторный канал был получен при возбуждении на 561 нм и эмиссионном фильтре 595/50.

Измерения фотообесцвечивания акцептора проводились на Nikon A1 с использованием иммерсионного объектива с плоским апохроматическим маслом и иммерсией 60x (NA1.4). Фотодеструкция применялась на длине волны 561 нм при 100% мощности лазера в течение одной секунды (лазер: Melles Griot 85-YCA-020, выходная мощность 20 мВт при 561 нм ± 0,5 нм).

Оценка изображений проводилась с использованием программного пакета Fiji из ImageJ (https://fiji.sc/) и набора самописных макросов FRET, которые находятся в свободном доступе под GPLv3 (General Public License версии 3). ) на GitHub под (https://github.com/BHochreiter). Предоставляется описание и протокол использования этих макросов для оценки (дополнительный рис.7).

Получение и оценка проточной цитометрии

Измерения FRET на основе проточной цитометрии были выполнены на приборе CYTOFLEX S (Beckman Coulter, серийный номер AW19039, используя следующие настройки каналов. Донорный канал: лазерное возбуждение 488 нм, 525/40 Эмиссионный фильтр БП (505–545 нм), канал FRET: лазерное возбуждение 488 нм, эмиссионный фильтр 610/20 БП (600-620 нм), канал акцептора: лазерное возбуждение 561 нм, эмиссионный фильтр 610/20 БП (600-620 нм)

Программа CytExpert (https: // www.beckman.com/coulter-flow-cytometers/software) использовался для сбора данных и стробирования анализируемых популяций. Программное обеспечение FlowPy (http://flowpy.wikidot.com/) использовалось для извлечения данных из файлового формата FCS в текстовый формат с разделителями табуляции.

Оценка отбеливания акцептора

В качестве альтернативного метода для определения эффективности FRET мы использовали метод фотообесцвечивания акцептора, который использует прямое сравнение интенсивности излучения донора до и после фотодеструкции акцепторного флуорофора, после чего большинство измерений и инструментов вызванные искажения не имеют значения, и поэтому результат является прямым коррелятом физического процесса.Однако многие флуорофоры демонстрируют определенные спектральные аномалии при освещении сильным источником света, которые необходимо учитывать перед анализом FRET. Донорские флуорофоры иногда могут быть совместно обесцвечены или, наоборот, фотоактивированы освещением с определенной длиной волны акцептора, что приводит к изменению сигнала флуоресценции без присутствия FRET. Другое явление — фотопереключение акцептора после обесцвечивания, когда акцептор не теряет свою эмиссию, а переходит на другой профиль эмиссии, который часто можно обнаружить в донорном канале 12,13 .

Поправочные коэффициенты df (совместное обесцвечивание и фотоактивация донора) и af (фотопереключение акцептора) используются для учета этих эффектов и определяются для образцов, содержащих только донор или акцептор.

$$ df = \ frac {{D} _ {dpost} — {D} _ {dpre}} {{D} _ {dpre}} $$

(2)

$$ af = \ frac {{D} _ {apost} — {D} _ {apre}} {{A} _ {apre} — {A} _ {apost}} $$

(3)

, где «пост» означает интенсивность после отбеливания с акцепторно-специфическим возбуждением, а «до» — значение до.{c}} $$

(5)

Расчет коэффициентов нормализации C1 и C2

Сигналы донора, FRET и акцептора требуют нормализации, чтобы преобразовать их в одно и то же измерение и сделать возможным расчет относительных концентраций и соотношений доноров и акцепторов. C1 и C2 нормализуют донор или акцептор соответственно к сигналу в канале FRET. Они требуют информации от конструкции с известной эффективностью переноса и стехиометрией. Каждый измеренный эксперимент включал популяцию, трансфицированную тандемной слитой конструкцией mCherry-YFP, которая удовлетворяет этим требованиям.{c} \ ast C2} $$

(8)

Расчет различных измерений FRET по полученным сигналам

Из-за спектральных свойств флуорофоров, сигналы донора, акцептора и канала FRET должны быть скорректированы на спектральные перекрестные помехи (или просачивание) от другого флуорофора. Во-первых, четыре спектральных коэффициента прохождения определяются с использованием образцов, содержащих только донорный или акцепторный флуорофор. В литературе можно найти разные номенклатуры для этих факторов — в данной работе используются S1 – S4 31 .S1 и S3 описывают спектральный поток донорной флуоресценции в FRET и акцепторный канал соответственно, тогда как S2 и S4 описывают спектральный поток акцепторной флуоресценции в FRET и донорный канал соответственно. (Список математических параметров в уравнениях представлен в таблице 1)

$$ {\ rm {donor}} \, {\ rm {into}} \, {\ rm {FRET}} \, {\ rm { channel}}: {S} _ {1} = \ frac {{F} _ {d}} {{D} _ {d}} $$

(9)

$$ {\ rm {acceptor}} \, {\ rm {into}} \, {\ rm {FRET}} \, {\ rm {channel}}: {S} _ {2} = \ frac { {F} _ {a}} {{A} _ {a}} $$

(10)

$$ {\ rm {donor}} \, {\ rm {into}} \, {\ rm {acceptor}} \, {\ rm {channel}}: {S} _ {3} = \ frac { {A} _ {d}} {{D} _ {d}} $$

(11)

$$ {\ rm {acceptor}} \, {\ rm {into}} \, {\ rm {donor}} \, {\ rm {channel}}: {S} _ {4} = \ frac { {D} _ {a}} {{A} _ {a}} $$

(12)

Таблица 1 Список переменных.{c} = \ frac {{A} _ {da} — {S} _ {3} \ ast {D} _ {da}} {1- {S} _ {3} \ ast {S} _ {4 }} $$

(14)

Если донор не подает сигнал в акцепторном канале и наоборот, что означает, что S3 и S4 равны 0, то этот шаг можно пропустить, и сигналы можно использовать сразу после коррекции фона.

Скорректированные донорные и акцепторные сигналы могут использоваться для отделения фактического сигнала FRET от спектрального просачивания в канале FRET, согласно Youvan et al .{c}} $$

(18)

Моделирование экспериментов FRET

Для моделирования экспериментов FRET мы создали математическую модель, основанную на обобщенной форме закона действия масс, которая описывает состояние всех химических взаимодействий в состоянии равновесия.

$$ A + B \ rightleftharpoons \ text {AB}, \, {K} _ {a} = \ frac {[AB]} {[A] \ ast [B]} $$

(19)

Состояние равновесия, или, точнее, концентрации свободных и связанных фракций молекул, зависит от концентраций реагентов, а также их сродства, описываемого константой сродства K a (или ее обратной величиной, константа диссоциации K d ).K a — постоянное значение для реакции при указанной температуре и давлении. Для расчета FRET мы можем использовать наши донор и акцептор как A и B соответственно.

$$ {K} _ {a} = \ frac {[complex]} {{[don]} _ {free} \ ast {[acc]} _ {free}} $$

(20)

$$ [сложный] = [don] — {[don]} _ {free} = [acc] — {[acc]} _ {free} $$

(21)

Когда эти формулы объединены и решены для [комплекса], количество связанных и свободных частиц может быть определено при заданной общей концентрации донора, акцептора и значения K a .{2}} + [don] {K} _ {a} + \ frac {[acc]} {z} {K} _ {a} +1} {2 {K} _ {a}} $$

(24)

Важно отметить, что этот способ введения фактора стехиометрии подразумевает, что многочисленные молекулы донора или акцептора, которые появляются в комплексе, уже связаны друг с другом до взаимодействия между молекулами донора и акцептора. Эта формула не может отражать сродство донорных или акцепторных субкомплексов по отдельности. {c} \) и F ​​ c можно рассчитать, применив фиксированное значение максимальной эффективности FRET FRET max , которое представляет эффективность FRET, если все донорные и акцепторные молекулы были задействованы в донорно-акцепторном комплексе, а также спектральные коэффициенты просачивания S1, S2, S3 и S4.

$$ {D} _ {da} = {[don]} _ {free} + [complex] \ ast (1-FRE {T} _ {max}) + ({[acc]} _ {free} + [сложный]) \ ast {S} _ {4} $$

(26)

$$ {A} _ {da} = {[acc]} _ {free} + [complex] + (\, {[don]} _ {free} + [complex] \ ast (1-FRE {T } _ {max})) \ ast {S} _ {3} $$

(27)

$$ {F} _ {da} = [комплекс] \ ast FRE {T} _ {max} + S1 \ ast {D} _ {da} + S2 \ ast {A} _ {da} $$

(28)

Для вычислительного моделирования модель можно упростить, установив для S1, S2, S3 и S4 значение 0, что не влияет на математическое моделирование.

Из полученных значений были рассчитаны показатели FRET в соответствии с уравнениями с 16 по 18.

Подгонка результатов FRET

Для получения трех количественных переменных K a app , z и FRET max , мы модифицировали результаты наших измерений в имитационную модель. Чтобы напрямую использовать интенсивности донорного и акцепторного каналов, а также результирующий DFRET для подгонки, мы немного изменили формулу, чтобы получить меру FRET вместо концентрации комплекса.{app}} \ ast \ frac {FRE {T} _ {max}} {don} $$

(31)

Подгонка проводилась с помощью нелинейной модели наименьших квадратов, что сводило к минимуму отклонение теоретических и реальных значений за несколько итераций. Подгонка модели может быть непосредственно применена к измеренным значениям, но должна быть ограничена значимой областью около стехиометрии комплекса. Для простого взаимодействия 1: 1 мы применяем модель ко всем значениям с отношением акцептора к донору от 0,2 до 2.

Статистическая информация

Статистические значения для подгонки модели были определены с помощью нелинейного алгоритма подгонки наименьших квадратов программного обеспечения R. Статистическая информация (где применимо) и n чисел приведены на соответствующих рисунках или в подписях к рисункам.

Реализованное программное обеспечение и код

Все описанные расчеты и оценки могут быть выполнены в свободно доступных ( R, ImageJ, CytExpert, FlowPy ) или общих (Microsoft Excel) программных пакетах.

Расчеты FRET, оценка FRET и моделирование были выполнены в Microsoft Excel (версия 2013). Приведены примеры таблиц данных (дополнительные шаблоны 1 и 2), включая пояснения по использованию и образец набора данных (дополнительные рисунки 8–10).

Подгонка модели

была выполнена в R (https://www.r-project.org/) с использованием команд нелинейной аппроксимации методом наименьших квадратов. Предоставляется код, используемый для фитинга (дополнительное примечание 2).

Весь написанный код, который использовался в этой работе, включая полностью автоматизированные макросы ImageJ и последовательности R-кода, предоставлен в качестве дополнения или доступен на Github по адресу https: // github.com / BHochreiter.

Биосенсоры на основе резонансной передачи энергии Фёрстера (FRET) для биологических приложений

Обзор

DOI: 10.1016 / j.bios.2019.05.019. Epub 2019 10 мая.

Принадлежности Расширять

Принадлежности

  • 1 Цзянсу, ключевая лаборатория фармакологии и оценки безопасности китайской Materia Medica, Фармацевтический факультет, Нанкинский университет китайской медицины, Нанкин, Цзянсу, 210023, Китай.
  • 2 Цзянсу, ключевая лаборатория фармакологии и оценки безопасности китайской Materia Medica, Фармацевтический факультет, Нанкинский университет китайской медицины, Нанкин, Цзянсу, 210023, Китай. Электронный адрес: [email protected]
  • 3 Цзянсу, ключевая лаборатория фармакологии и оценки безопасности китайской Materia Medica, Фармацевтический факультет, Нанкинский университет китайской медицины, Нанкин, Цзянсу, 210023, Китай.Электронный адрес: [email protected]

Элемент в буфере обмена

Обзор

Xiaojing Zhang et al. Biosens Bioelectron. .

Показать детали Показать варианты

Показать варианты

Формат АннотацияPubMedPMID

DOI: 10.1016 / j.bios.2019.05.019. Epub 2019 10 мая.

Принадлежности

  • 1 Цзянсу, ключевая лаборатория фармакологии и оценки безопасности китайской Materia Medica, Фармацевтический факультет, Нанкинский университет китайской медицины, Нанкин, Цзянсу, 210023, Китай.
  • 2 Цзянсу, ключевая лаборатория фармакологии и оценки безопасности китайской Materia Medica, Фармацевтический факультет, Нанкинский университет китайской медицины, Нанкин, Цзянсу, 210023, Китай. Электронный адрес: [email protected]
  • 3 Цзянсу, ключевая лаборатория фармакологии и оценки безопасности китайской Materia Medica, Фармацевтический факультет, Нанкинский университет китайской медицины, Нанкин, Цзянсу, 210023, Китай.Электронный адрес: [email protected]

Элемент в буфере обмена

Полнотекстовые ссылки Опции CiteDisplay

Показать варианты

Формат АннотацияPubMedPMID

Абстрактный

Биосенсоры на основе резонансной передачи энергии Фёрстера (FRET) достигли большого успеха в биологических приложениях.Тем не менее, что не получает должного признания, так это растущая роль универсальных биосенсоров FRET в аналогичном биологическом контексте. В этом обзоре дается краткое описание последних достижений в принципе, стратегий проектирования и видов применения биосенсоров FRET. Для каждого биосенсора FRET соответствующие предыстория и изготовление объясняются до изучения их связанных приложений. Видная роль наноматериалов присутствует в разработке более чувствительных и специфических биосенсоров FRET.Наконец, подчеркиваются проблемы и перспективы использования биосенсоров FRET.

Ключевые слова: FRET; Флуоресцентный биосенсор; Мульти-FRET; Наноматериалы; Наномедицина.

Авторские права © 2019. Издатель Elsevier B.V.

Похожие статьи

  • Белковые биосенсоры, основанные на принципе резонансного переноса энергии флуоресценции для мониторинга клеточной динамики.

    Ли И.Т., Фам Э., Чыонг К. Ли ИТ и др. Biotechnol Lett. 2006 декабрь; 28 (24): 1971-82. DOI: 10.1007 / s10529-006-9193-5. Epub 2006 5 октября. Biotechnol Lett. 2006 г. PMID: 17021660 Рассмотрение.

  • Разработка биосенсоров FRET для систем млекопитающих и растений.

    Хамерс Д., ван Ворст Вейдер Л., Борст Дж. В., Годхарт Дж. Hamers D, et al.Протоплазма. 2014 Март; 251 (2): 333-47. DOI: 10.1007 / s00709-013-0590-z. Epub 2013 12 декабря. Протоплазма. 2014 г. PMID: 24337770 Рассмотрение.

  • Анализ флуоресцентного резонансного переноса энергии (FRET) для биологических приложений на основе графена и графеноподобных материалов двух наименований.

    Тиан Ф, Лю Дж, Ши Дж, Ян М. Тиан Ф. и др. Biosens Bioelectron.2017 15 марта; 89 (Pt 1): 123-135. DOI: 10.1016 / j.bios.2016.06.046. Epub 2016 17 июня. Biosens Bioelectron. 2017 г. PMID: 27342369 Рассмотрение.

  • Биосенсоры на основе флуоресцентного резонансного переноса энергии (FRET): визуализация клеточной динамики и биоэнергетики.

    Задран С., Стэндли С., Вонг К., Отиниано Э., Амиги А., Бодри М. Задран С. и др. Appl Microbiol Biotechnol.2012 ноябрь; 96 (4): 895-902. DOI: 10.1007 / s00253-012-4449-6. Epub 2012 6 октября. Appl Microbiol Biotechnol. 2012 г. PMID: 23053099 Рассмотрение.

  • Флуоресцентные белки как генетически кодируемые биосенсоры FRET в науках о жизни.

    Хохрайтер Б., Гарсия А. П., Шмид Я. Hochreiter B, et al. Датчики (Базель). 2015 16 октября; 15 (10): 26281-314. DOI: 10,3390 / s151026281. Датчики (Базель).2015 г. PMID: 26501285 Бесплатная статья PMC. Рассмотрение.

Процитировано

12 статей
  • Передний край моделирования заболеваний: синергия технологии индуцированных плюрипотентных стволовых клеток и генетически кодированных биосенсоров.

    Валетдинова К.Р., Маланханова Т.Б., Закян С.М., Медведев С.П.Валетдинова К.Р. и др. Биомедицина. 2021 5 августа; 9 (8): 960. DOI: 10.3390 / biomedicines60. Биомедицина. 2021 г. PMID: 34440164 Бесплатная статья PMC. Рассмотрение.

  • Перенос энергии резонанса флуоресценции (FRET) на основе наноматериалов и флуоресценция с усилением металлов (MEF) для обнаружения нуклеиновых кислот в диагностике рака.

    Чой Дж. Х., Ха Т, Шин М., Ли С. Н., Чой Дж. В.. Чой Дж. Х. и др.Биомедицина. 2021 31 июля; 9 (8): 928. DOI: 10.3390 / biomedicines28. Биомедицина. 2021 г. PMID: 34440132 Бесплатная статья PMC. Рассмотрение.

  • Логометрический флуоресцентный зонд ближнего инфракрасного диапазона на основе новой реактивной цианиновой платформы для определения pH митохондрий.

    Wan S, Xia S, Medford J, Durocher E, Steenwinkel TE, Rule L, Zhang Y, Luck RL, Werner T., Лю Х.Ван С. и др. J Mater Chem B. 2021, 7 июля; 9 (25): 5150-5161. DOI: 10.1039 / d1tb00643f. Epub 2021 16 июня. J Mater Chem B. 2021. PMID: 34132313

  • Метаболические перекрестные помехи глюкозы и регуляция функции мозга и заболеваний.

    Чжан С., Лашанс ББ, член парламента Маттсона, Цзя Х. Zhang S, et al. Prog Neurobiol. 2021 Сен; 204: 102089. DOI: 10.1016 / j.pneurobio.2021.102089. Epub 2021 10 июня. Prog Neurobiol. 2021 г. PMID: 34118354 Рассмотрение.

  • Количественная оценка и визуализация наномасштабного контакта с резонансной передачей энергии Фёрстера.

    Simões MG, Urstöger G, Schennach R, Hirn U. Simões MG, et al. Интерфейсы ACS Appl Mater. 2021, 28 апреля; 13 (16): 19521-19529. DOI: 10.1021 / acsami.1c04226. Epub 2021 15 апреля. Интерфейсы ACS Appl Mater.2021 г. PMID: 33856765 Бесплатная статья PMC.

Условия MeSH

  • Методы биосенсинга / инструменты
  • Методы / методы биосенсинга *
  • Флуоресцентный резонансный перенос энергии / методы
  • Флуоресцентные красители / химия
  • Наноструктуры / химия
[Икс]

цитировать

Копировать

Формат: AMA APA ГНД NLM

На основе активности ратиометрического зонда FRET выявляются обусловленные онкогеном изменения в лабильных пулах меди, вызванные измененным метаболизмом глутатиона

Медь является необходимым окислительно-восстановительным питательным веществом для жизни (1), выступая в качестве мощного каталитического и / или структурного кофактора в белках для фундаментальные процессы, такие как транспорт кислорода, дыхание и метаболизм, рост и дифференцировка клеток, а также передача сигналов (2–6).В дополнение к прочно связанным пулам меди, скрытым в активных центрах металлопротеинов, новые данные свидетельствуют о наличии лабильных пулов меди, которые относительно слабо связаны низкомолекулярными лигандами (7). Лабильные пулы меди вносят вклад в растущее число динамических сигнальных путей переходных металлов (8), включая нейронную коммуникацию (9⇓ – 11), обоняние (12, 13), липолиз (6), циклы покоя-активности (14) и киназные пути. участвуют в передаче сигналов и онкогенезе (5, 15). Действительно, нарушение регуляции меди может привести к аберрантным явлениям окислительного и нитрозативного стресса, которые сопровождают заболевания, включая рак (5, 16), сердечно-сосудистые расстройства, нейродегенеративные болезни Альцгеймера, Паркинсона и Хантингтона (3, 17), диабет и ожирение, а также генетические болезни Менкеса и Вильсона. расстройства (18⇓⇓ – 21).

Дихотомия сигнал / стресс для меди мотивирует разработку новых химических инструментов, помогающих расшифровать более широкий вклад меди в физиологию и патологию. В этом контексте флуоресцентные (6, 10, 11, 14, 22⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓ – 38), биолюминесцентные (39) и магнитно-резонансные датчики (40⇓ – 42) для визуализации лабильных медных пулов со специфичностью металла и степени окисления, особенно при использовании совместно с дополнительными методами измерения общего содержания металлов (22, 43, 44), включая масс-спектрометрию с индуктивно связанной плазмой с лазерной абляцией (LA-ICP-MS) (45 ⇓ – 47), наномасштабная вторичная ионная масс-спектрометрия (38, 48) и рентгеновская флуоресцентная микроскопия (10, 49, 50) могут обеспечить согласованную картину гомеостаза металлов для данной биологической модели.Таким образом, химическое ограничение в разработке флуоресцентных зондов состоит в том, что подавляющее большинство индикаторов меди на сегодняшний день реагируют только на изменения интенсивности флуоресценции в одном цвете, что может усложнить количественные измерения пулов меди и / или сравнение уровней меди в разных биологические образцы из-за возможных вариаций в захвате зонда наряду с помехами, возникающими из-за независящих от меди явлений, таких как неоднородность толщины образца и интенсивности света (51, 52).Чтобы решить эту проблему, логометрические зонды, в которых используются спектральные изменения возбуждения / излучения для 2 или более длин волн, в принципе могут обеспечить внутреннюю самокалибровку для неоднородной нагрузки зонда и ограничить интерференцию между различными образцами (53–57). Однако большинство ратиометрических флуоресцентных индикаторов меди, о которых сообщалось на сегодняшний день, в значительной степени ограничены отсутствием специфичности степени окисления и / или снижением общей интенсивности флуоресценции при обнаружении меди (31–37).

Теперь мы представляем разработку, синтез и биологические применения логометрического флуоресцентного индикатора меди первого поколения, зонда-1 с резонансным переносом энергии флуоресценции (FRET) (FCP-1).Этот сенсорный зонд на основе активности использует хемоселективное Cu (I) -зависимое окислительное расщепление C-O трис [(2-пиридил) метил] аминовой (ТРА) (28, 58, 59) единицы, связывающей единицы донора флуоресцеина и акцептора родамина. (Схема 1). Высокая металлоспецифичность и степень окисления FCP-1 для Cu (I), наряду с его двухцветным ратиометрическим ответом FRET, позволяет использовать его для мониторинга динамических изменений в лабильных пулах Cu (I) в живых клетках. Благодаря самокалибровке, обеспечиваемой логометрическим ответом, FCP-1 был способен надежно обнаруживать снижение эндогенных уровней лабильной Cu (I) в эмбриональных фибробластах мыши (MEF), лишенных высокоаффинного переносчика меди Ctr1 ( Ctr1). — / — ) относительно сородичей дикого типа.Дальнейшие эксперименты выявили колебания лабильных уровней Cu (I), но не общих уровней меди, в условиях окислительно-восстановительного стресса, вызванного генетическими изменениями путей биосинтеза глутатиона. Интересно, что дефицит лабильных пулов Cu (I) был обнаружен при введении онкогенных BRAF V600E или KRAS G12D , связывающих лабильную дисрегуляцию меди с онкоген-зависимым окислительно-восстановительным статусом. Способность FCP-1 контролировать лабильные пулы Cu (I) с помощью логометрического ответа обеспечивает отправную точку для дальнейших исследований окислительно-восстановительного вклада в передачу сигналов переходных металлов.

Результаты и обсуждение

Дизайн, синтез и характеристика FCP-1.

Вдохновленный биоинорганическими модельными соединениями TPA, которые демонстрируют Cu (I) -зависимую химию окислительного расщепления (28, 58, 59), наша конструкция FCP-1 на схеме 1 соединяет донор флуоресцеина FRET и акцептор родамина FRET с медь-чувствительным TPA. компоновщик. Изменения в лабильных уровнях Cu (I) могут модулировать внутримолекулярную эффективность FRET и приводить к разной интенсивности флуоресценции донора и акцептора на 2 разных длинах волн, которые могут быть самокалиброваны ратиометрическим способом.При более низких уровнях Cu (I) зонд остается нетронутым с более высоким FRET и доминирующей эмиссией родамина, с более высокими уровнями Cu (I), ведущими к медьзависимому окислительному расщеплению линкера TPA и более низкому FRET и эмиссии с преобладанием флуоресцеина.

Синтез FCP-1 начинается с получения метилового эфира флуоресцеина, функционализированного 2-бромметилпиридином ( 2 ), и родамина, функционализированного пиколиламином ( 5 ; схема 2). Соединение 2 было синтезировано в 2 стадии из ранее описанного метилового эфира флуоресцеина путем нуклеофильного замещения на 6- (бромметил) -2-пиридинметанол и последующего бромирования метилового спирта.Параллельно получали нозил-защищенный пиколиламин ( 3 ) путем монозамещения бис (хлорметил) пиридина из 4-нитро- N — (2-пиридинилметил) бензолсульфонамид и затем подвергали реакции с родамином, функционализированным пиперазинилом (Pz-родамином). позволить себе 4 . Затем с нозильной группы 4 снимают защиту тиофенолом и K 2 CO 3 с получением 5 . Имея в руках ключевые элементы 2 и 5 , мотив TPA может быть сгенерирован путем нуклеофильного замещения 2-бромметильной группы на 2 пиколиламином на 5 в основных условиях, что дает конечный ратиометрический зонд FCP-1 который был охарактеризован 1 H и 13 C { 1 H} ЯМР, МС высокого разрешения и МС с жидкостной хроматографией (ЖХ-МС; SI Приложение , рис.S1). Зонд на основе интенсивности Cu (I) FL-TPA был приготовлен в качестве контрольного соединения с тем же триггером восприятия на основе активности на основе Cu (I) и флюоресцеиновым каркасом, но без ратиометрического ответа (схема 2).

Схема 2.

Синтез FCP-1 и контрольного зонда FL-TPA.

Реакционная способность и селективность FCP-1 по отношению к меди.

Известно, что внутриклеточная среда восстанавливается и содержит высокие концентрации биомолекул, что приводит к скоплению макромолекул (60, 61).Таким образом, чтобы имитировать аспекты этих свойств in vitro, мы оценили FCP-1 в буфере PBS, содержащем глутатион (2 мМ) и полиэтиленгликоль (PEG) -400 (40%, об. / Об.). FCP-1 показал максимумы поглощения при 465, 493 и 552 нм с молярными коэффициентами экстинкции 20 000, 22 100 и 40 000 M -1 см -1 , соответственно ( SI Приложение , рис. S2). Первые 2 максимума поглощения соответствовали поглощению флуоресцеиновой составляющей, поскольку аналогичные максимумы поглощения при 460 и 489 нм были обнаружены в спектрах поглощения FL-TPA ( SI Приложение , рис.S2) и сообщил о моноклеточном метиловом эфире флуоресцеина (62, 63), в то время как самое низкое поглощение энергии при 552 нм происходило от части родамина ( SI, приложение , рис. S2). При фотовозбуждении при 458 нм было обнаружено, что FCP-1 испускает при 526 и 576 нм (фиг. 1 A ), что соответствует сигнатурам флуоресцеина и родамина, соответственно. Примечательно, что строительный блок Pz-родамин показывает только слабое поглощение при 458 нм ( SI Приложение , рис. S2). Вместе со значительным вкладом низкоэнергетической флуоресценции от возбуждения от 450 до 500 нм, что находится в области поглощения FL-TPA ( SI Приложение , рис.S3), данные подтверждают наличие FRET от донора флуоресцеина к акцептору родамина. При использовании FL-TPA в качестве эталонного соединения-донора FRET ( SI Приложение , рис. S4) с предположением, что тушение флуоресценции донора происходит только из процесса FRET, эффективность FRET в кассете FCP-1 оценивается в 84%. .

Рис. 1.

Фотофизические свойства и селективность Cu (I) FCP-1 в водных буферных растворах. ( A ) Изменения скорректированных спектров излучения FCP-1 (5 мкМ) в водном буферном растворе.( Вставка ) Изменение ратиометрического излучения FCP-1, F 526 / F 576 , с Cu (I) (10 мкМ) с течением времени. ( B ) Скорректированные спектры излучения FCP-1, измеренные при различных концентрациях. ( C ) Никаких значительных изменений в соотношении выбросов F 526 / F 576 при различных концентрациях FCP-1 не наблюдается. ( D ) Изменения в F 526 / F 576 отношение FCP-1 (5 мкМ) к различным биологически значимым ионам металлов, а также к кобальт (II) -содержащему витамину B 12 .Черные столбцы представляют собой логометрический отклик излучения, наблюдаемый при добавлении конкурирующих ионов металлов (1 мМ для Na + , K + , Mg 2+ и Ca 2+ и 10 мкМ для всех остальных d- блокируют ионы металлов, а также витамин B 12 ) через 15 мин. Красные столбцы представляют собой логометрическую реакцию эмиссии при последующем добавлении 10 мкМ Cu (I) через 15 мин. Обозначения: 1, Na + ; 2, К + ; 3, Mg 2+ ; 4, Ca 2+ ; 5, Mn 2+ ; 6, Fe 2+ ; 7, 10 мкМ Co 2+ ; 8, 1 мкМ Co 2+ ; 9, витамин B 12 ; 10, Ni 2+ ; 11, Cu + ; 12, Zn 2+ .( E ) Спектры излучения и ( F ) F 526 / F 576 коэффициент излучения (черный) FCP-1 (5 мкМ) или FCP-1 с добавлением (красного) Cu (II) (10 мкМ), (синий) Cu (II) (10 мкМ) + GSH (2 мМ) или (голубой) Cu (I) (10 мкМ) + GSH (2 мМ) через 15 мин. Все спектры снимали в водном буфере (PBS с 2 мМ GSH и 40 об.% PEG-400) с λ ex = 458 нм.

При добавлении Cu (I) FCP-1 показал увеличение эмиссии флуоресцеина при 526 нм с течением времени с одновременным падением флуоресценции родамина при 576 нм (рис.1 А ). Анализ ЖХ-МС подтверждает образование фрагментов метилового эфира флуоресцеина ( P1 ) и родамин-TPA ( P2 ) при добавлении Cu (I) к раствору FCP-1 ( SI Приложение , Рис. S5) и аэробные условия необходимы для запуска спектральных изменений эмиссии ( SI Приложение , рис. S6), согласующихся с Cu (I) -опосредованным окислительным расщеплением связи C-O бензилового эфира на линкере TPA FCP-1. Это расщепление C – O приводит к отделению донора флуоресцеина от акцептора родамина и, следовательно, приводит к снижению внутримолекулярной эффективности FRET с ратиометрическим изменением спектра излучения (рис.1 А ). Логометрическое изменение флуоресценции FCP-1 при 526 и 576 нм ( F 526 / F 576 ) было быстрым и достигло насыщения после ~ . 30 мин в присутствии 2-кратного избытка Cu (I) (10 мкМ). Примечательно, что соотношение FCP-1 F 526 / F 576 показало линейную дозозависимую реакцию при добавлении Cu (I) от 0,01 до 1 мкМ ( SI Приложение , рис. S7 A ), подчеркивая способность FCP-1 определять уровни Cu (I) в этом диапазоне по логометрическому изменению флуоресценции.FCP-1 показал высокую чувствительность к Cu (I), о чем свидетельствуют обнаруживаемые спектральные изменения излучения при 10 нМ Cu (I) ( SI Приложение , рис. S7 B ) и предел обнаружения 16,7 нМ на основе метод 3σ из 5 независимых экспериментов (64, 65). Что еще более интересно, базальный коэффициент эмиссии F 526 / F 576 FCP-1 не показал значительных изменений при различных концентрациях зонда (от 0,5 до 20 мкМ; рис. 1 B и C ). .Эта внутренняя самокалибровка имеет преимущество, поскольку было обнаружено, что FCP-1 менее флуоресцирует при более высоких концентрациях, предположительно из-за самотушения, которое является общей проблемой, обнаруживаемой у флуорофоров ( SI Приложение , рис. S8) (66) . Действительно, незначительные изменения в ратиометрической эмиссии FCP-1 указывают на то, что FRET происходит главным образом по внутримолекулярному механизму, а ратиометрическая флуоресценция FCP-1, не зависящая от концентрации, дополнительно подчеркивает его потенциал в сравнительной визуализации лабильных пулов Cu (I) в биологических образцах с помощью предотвращение возможных осложнений, возникающих из-за различий в захвате зонда, толщине образца и интенсивности света.

Логометрическое изменение флуоресценции FCP-1 было селективным в отношении Cu (I) по сравнению с другими биологически значимыми ионами металлов, за исключением свободного Co (II) при 10 мкМ, который незначительно изменял флуоресценцию FCP-1 (рис. 1 D ). Примечательно, что эта концентрация экзогенного Со (II) намного выше, чем физиологически значимые уровни лабильного Со (II), поскольку известно, что этот ион металла прочно связан с белками. Действительно, FCP-1 не показал значительных изменений в ратиометрическом сигнале в присутствии 10 мкМ кобаламина (витамин B 12 ) (67), который является преобладающей формой Co (II) в системах млекопитающих, что позволяет предположить, что вмешательство в обнаружение содержания Cu (I) с помощью FCP-1 из Co (II) в биологических образцах должно быть незначительным.Конкурентные эксперименты также показали способность FCP-1 обнаруживать Cu (I) в растворах, содержащих другие биологически релевантные ионы металлов (рис. 1 D ). В дополнение к проявлению селективности по металлу, ратиометрический отклик FCP-1 зависит от степени окисления для Cu (I), поскольку зонд не реагирует ратиометрически на Cu (II) (рис. 1 E и F ). В качестве дополнительного подтверждения этой селективности по степени окисления совместимость FCP-1 с Cu (II) и избытком глутатиона, который легко восстанавливает Cu (II) до Cu (I), приводит к спектрам излучения и F 526 / Соотношение F 576 , которое идентично полученному при обработке FCP-1 Cu (I) и избытком глутатиона (рис.1 E и F ). Эта специфичность состояния окисления важна для приложений FCP-1 при визуализации динамических изменений внутриклеточных лабильных пулов Cu (I) в условиях окислительно-восстановительного стресса и онкогенной трансформации, которые мы опишем позже.

Наконец, FCP-1 не реагирует на Ag (I), который является близким аналогом Cu (I), но лишен сильной кислородзависимой окислительно-восстановительной активности ( SI Приложение , рис. S9). Ввиду низкой растворимости Ag (I) в присутствии хлорид-и других галогенид-ионов, буферный раствор NaH 2 PO 4 (50 мМ, pH 7.4) вместо раствора PBS в этих сериях экспериментов. Действительно, в присутствии Ag (I) не наблюдалось значительного изменения соотношения F 526 / F 576 , в то время как Cu (I) вызывал увеличение патента F 526 / F. 576 соотношение FCP-1 в том же буферном растворе ( SI Приложение , рис. S9). Эти данные предполагают, что наблюдаемые ратиометрические изменения флуоресценции FCP-1 при добавлении Cu (I) объясняются окислительно-восстановительной активностью Cu (I).Кроме того, было обнаружено, что присутствие восстанавливающих агентов имеет решающее значение для запуска логометрических изменений флуоресценции FCP-1, опосредованных Cu (I) ( SI Приложение , рис. S10), и действительно, аналогичные изменения флуоресценции наблюдались также при использовании аскорбата. вместо 2 мМ глутатиона (GSH) в качестве восстановителя ( SI Приложение , рис. S11). Наряду с наблюдаемым увеличением уровней GSSG (окисленной формы GSH) с сопутствующим падением уровней GSH (восстановленной формы) при добавлении Cu (I) к смеси растворов FCP-1 и GSH ( SI Приложение , Инжир.S5 A ), эти данные подтверждают роль восстанавливающих агентов в «рециркуляции» редокс-активных частиц Cu (I) для связывания с рецептором TPA и запуска последующего основанного на активности расщепления связи C-O бензилового эфира на компоновщик. Это расщепление связи происходит в основном по окислительному механизму, поскольку при добавлении Cu (I) в анаэробных условиях не наблюдается значительных изменений спектра излучения ( SI Приложение , рис. S6). Образование метилового эфира флуоресцеина и фрагментов родамин-TPA ( SI Приложение , рис.S5) приводит к снижению внутримолекулярной эффективности FRET и увеличению отношения F 526 / F 576 .

FCP-1 может отображать лабильные пулы Cu (I) в живых клетках.

Учитывая избирательную и чувствительную реакцию FCP-1 на металл и состояние окисления на Cu (I), мы попытались применить этот зонд для логометрической флуоресцентной визуализации лабильных пулов Cu (I) в живых клетках. С этой целью клетки HEK 293T подвергали воздействию различных доз CuCl 2 (от 25 до 300 мкМ), тщательно промывали для удаления избытка меди из среды, а затем инкубировали с FCP-1 (5 мкМ) в течение 45 минут и визуализировали. .Клетки, дополненные медью, показали статистически значимое, дозозависимое увеличение соотношения F зеленый / F оранжевый по сравнению с контрольными клетками носителя (фиг. 2 B ). Напротив, медь-дефицитные клетки HEK 293T, полученные обработкой непроницаемым для мембран хелатором меди, батокупроинсульфонатом (BCS; 100 мкМ), промытые и впоследствии инкубированные с FCP-1 (5 мкМ), показали статистически значимое снижение F зеленый / F оранжевый соотношение по сравнению с контрольными клетками (рис.2 C и D ). Наблюдаемое увеличение и уменьшение лабильных уровней Cu (I) при добавлении меди (CuCl 2 ) и лечении истощения запасов меди (BCS), соответственно, как измерено с помощью визуализации FCP-1, было подтверждено дополнительными измерениями общих уровней меди с помощью ИСП-МС. демонстрируя ожидаемые увеличения и уменьшения общего пула меди (рис. 2 E ). Контрольные эксперименты показали, что клетки оставались жизнеспособными, на что указывало ядерное окрашивание ( SI Приложение , фиг.S12 и S13). Эти данные показывают, что FCP-1 способен визуализировать как увеличение, так и уменьшение лабильных пулов Cu (I) в живых клетках с помощью логометрического считывания флуоресценции.

Рис. 2.

Ратиометрическая флуоресцентная визуализация лабильных уровней Cu (I) в живых клетках с использованием FCP-1. ( A ) Изображения конфокальной флуоресцентной микроскопии клеток HEK 293T, предварительно обработанных контрольным растворителем-носителем или различными концентрациями CuCl 2 в полной среде в течение 18 часов. Затем клетки промывали PBS, инкубировали с FCP-1 (5 мкМ) в DPBS в течение 45 минут, а затем отображали.( B ) Средние коэффициенты излучения клеток, представленные как F зеленый / F оранжевый , как определено в экспериментах по визуализации в A , выполненных в трех экземплярах. ( C ) Изображения конфокальной флуоресцентной микроскопии клеток HEK 293T, предварительно обработанных контрольным растворителем-носителем или BCS (100 мкМ) в полной среде в течение 18 часов. Затем клетки промывали PBS, инкубировали с FCP-1 (5 мкМ) в DPBS в течение 45 минут, а затем отображали. ( D ) Средние коэффициенты излучения клеток FCP-1, F зеленый / F оранжевый , как определено в экспериментах в C , проведенных в трех повторностях. A и C отображаются в псевдоцвете и относятся к базовому контролю для этого эксперимента и независимо друг от друга. λ ex = 458 нм. ( E ) Измерение ICP-MS для определения общего клеточного уровня 63 Cu в клетках HEK 293T при добавлении и истощении меди относительно контроля (с нормализацией различных количеств клеток по общему клеточному уровню 31 P). Планки погрешностей обозначают стандартное вычисление (SD; n = 3).* P <0,05, ** P <0,01, *** P <0,001, **** P <0,0001 и ***** P <0,00001.

FCP-1 может отслеживать различия в уровнях лабильного Cu (I) в генетической клеточной модели неправильной регуляции меди.

Установив, что FCP-1 чувствителен к эндогенным пулам лабильной Cu (I) в базовых условиях и может реагировать на изменения лабильных пулов Cu (I) при фармакологическом добавлении и / или истощении меди, мы попытались изучить применение FCP-1 для визуализации изменений в эндогенных лабильных пулах Cu (I) посредством генетических манипуляций.С этой целью мы выполнили сравнительную визуализацию FCP-1 в клетках эмбриональных фибробластов мыши, которые являются либо Cu-избыточными ( Ctr1 + / + MEF), либо Cu-дефицитными ( Ctr1 — / — . MEFs) через нокаут высокоаффинного переносчика меди CTR1 (68⇓ – 70). Как и ожидалось, Ctr1 + / + MEF, инкубированные с FCP-1, показали более высокие отношения F зеленый / F оранжевый по сравнению с Ctr1 — / — ( P <0.01; 3 A и B ), что указывает на то, что FCP-1 может точно определять относительное снижение эндогенных уровней лабильной Cu (I) в клетках, дефицитных по поглощению меди.

Рис. 3.

FCP-1 позволяет проводить сравнительную визуализацию уровней лабильных Cu (I) в живых клетках с измененными уровнями экспрессии высокоаффинного белка захвата меди CTR1. ( A ) Изображения конфокальной флуоресцентной микроскопии Ctr1 + / + MEF и Ctr1 — / — MEF, обработанных контролем растворителя, CuCl 2 (100 или 300 мкМ), или BCS (500 мкМ) в полной среде в течение 8 ч, промывали полной средой и PBS, инкубировали с FCP-1 (5 мкМ) в DPBS в течение 45 мин, а затем отображали с λ ex = 458 нм.( B ) Средние коэффициенты излучения клеток FCP-1, F зеленый / F оранжевый , как определено из экспериментов, проведенных в трех повторностях. ( C ) Изображения конфокальной флуоресцентной микроскопии Ctr1 + / + MEF и Ctr1 — / — MEF, инкубированных с FL-TPA (5 мкМ) в DPBS в течение 45 мин. Затем клетки получали изображение с λ ex = 488 нм. ( D ) Средняя интенсивность клеточной флуоресценции FL-TPA, F FL-TPA , определенная из экспериментов, проведенных в трех повторностях с λ ex = 488 нм.Планки погрешностей обозначают SD ( n = 3). * P <0,05, ** P <0,01 и **** P <0,0001.

Для дальнейшего подтверждения способности FCP-1 контролировать дифференциальные уровни лабильного Cu (I) в клетках, Ctr1 + / + MEF, инкубированные с различными концентрациями CuCl 2 , показали дозозависимое увеличение в FCP-1 F зеленый / F оранжевый соотношение. Напротив, в Ctr1 — / — MEF, инкубированных с CuCl 2 и затем визуализированных с FCP-1 ( Инжир.3 A и B ). Тем временем жизнеспособность клеток поддерживалась, что подтверждено ядерным красителем DRAQ5 ( SI, приложение , фиг. S14 и S15). Разница в ответе ратиометрической флуоресценции FCP-1 на добавление экзогенной меди между MEF дикого типа и нокаутом по Ctr1 согласуется с неэффективным поглощением меди, а не с изменениями оттока меди, как обработка Ctr1 — / — МЭФ с мембранно-непроницаемым хелатором меди BCS привели к снижению отношения F зеленый / F оранжевый , аналогично тому, что наблюдается в Ctr1 + / + MEF (рис.3 A и B ). Дополнительные измерения ICP-MS подтверждают, что общие базальные уровни меди в MEF Ctr1 — / — ниже, чем Ctr1 + / + MEF ( SI Приложение , рис. S16). Важно отметить, что логометрический ответ FCP-1 является ключом к его способности различать базальный и пониженный уровни лабильной Cu (I). Действительно, контрольный зонд FL-TPA, который демонстрирует флуоресцентный ответ «включается» без ратиометрической самокалибровки, не смог различить различия в базальных лабильных уровнях Cu (I) в Ctr1 + / + MEF. и Ctr1 — / — MEF (рис.3 C и D ), при этом обнаруживая изменения в лабильной меди с добавлением экзогенной меди ( SI Приложение , рис. S17). Этот результат может быть объяснен потенциальными различиями в загрузке зонда в 2 клеточные линии MEF, что дополнительно подчеркивает самокалибрующуюся природу ратиометрического зонда FCP-1 как критическую особенность для точного определения уровней аналита в различных, изменчивых биологических образцах. Наконец, мы проверили, может ли FCP-1 нарушить лабильные пулы Cu, измеряя уровни белка CCS в MEF, обработанных FCP-1 или BCS, последний в качестве положительного контроля для снижения содержания Cu в клетках и повышения стабильности белка CCS.Действительно, уровни белка CCS не изменились в клетках, обработанных концентрацией FCP-1, достаточной для визуализации клеточных лабильных пулов Cu, в то время как обработка BCS увеличивала CCS, как и ожидалось ( SI Приложение , рис. S18), подтверждая, что FCP-1, сам по себе не изменяет клеточные уровни Cu в этих условиях. Данные демонстрируют, что FCP-1 может контролировать базальные уровни эндогенно лабильного Cu (I) и истощение таких пулов в ответ на снижение клеточного поглощения меди с помощью генетических или фармакологических средств.

FCP-1 определяет динамическое изменение лабильного Cu (I) по сравнению с общим пулом меди в живых клетках при окислительно-восстановительном стрессе.

Принимая во внимание специфичность степени окисления FCP-1 по отношению к Cu (I), мы исследовали влияние окислительно-восстановительного статуса клеток на лабильные пулы Cu (I), которое остается недостаточно изученным. Во-первых, мы подтвердили способность FCP-1 обнаруживать изменения в лабильных уровнях Cu (I) в клетках HeLa с помощью CuCl 2 и лечения BCS (рис. 4 A ). Затем мы наблюдали за эффектом добавления аскорбата, который является мощным восстановителем, на внутриклеточные лабильные пулы Cu (I).Интересно, что мы наблюдали статистически значимое увеличение соотношения FCP-1 F зеленый / F оранжевый , что свидетельствует об увеличении лабильных уровней Cu (I) в клетках, обработанных аскорбатом, по сравнению с контрольными клетками (рис. 4 В ) (31). Поскольку сопутствующие измерения ICP-MS не показали изменений общего уровня меди в клетках, обработанных аскорбатом, по сравнению с контрольными носителями (рис. 4 C ), увеличение F зеленый / F оранжевый может быть объясняется повышением лабильных уровней Cu (I).Несколько потенциальных факторов могут способствовать этому наблюдению в ответ на этот экзогенный восстановитель, включая сдвиг в глобальном или локальном окислительно-восстановительном балансе Cu (I) / Cu (II), снижение клеточной или субклеточной способности буферизовать Cu (I) и / или перемещение / рекомпарментализация лабильных пулов Cu (I).

Рис. 4.

FCP-1 идентифицирует изменения в лабильном уровне Cu (I), но не в общем уровне меди в живых клетках при окислительно-восстановительном стрессе. Изображения конфокальной флуоресцентной микроскопии клеток HeLa, предварительно обработанных контрольным растворителем ( A ), CuCl 2 (200 или 300 мкМ) или BCS (100 мкМ) в полной среде в течение 18 ч или контрольным растворителем ( B ), аскорбатом (1 мМ) или BSO (1 мМ) в полной среде в течение 4 часов.Затем клетки промывали PBS, инкубировали с FCP-1 (5 мкМ) в DPBS в течение 45 мин и отображали с λ ex = 458 нм. Гистограммы показывают среднюю ратиометрическую эмиссию FCP-1 клеток, F зеленый / F оранжевый , определенную из экспериментов, проведенных в трех повторностях. ( C ) Общие клеточные уровни 63 Cu определяли с помощью экспериментов ICP-MS (с нормализацией различных количеств клеток по общему клеточному уровню 31 P).Планки погрешностей обозначают SD ( n = 3). * P <0,05, ** P <0,01, *** P <0,001 и **** P <0,0001, и не показывают изменений ни при обработке аскорбатом, ни при обработке BSO.

Имея эти результаты в руках, мы затем попытались использовать FCP-1 для изучения потенциальных связей между поддержанием лабильных пулов Cu (I) и эндогенными центральными окислительно-восстановительными медиаторами в клетке. В этом контексте глутатион (GSH) является повсеместно встречающимся в природе антиоксидантом и ключевой небольшой молекулой для поддержания надлежащего клеточного окислительно-восстановительного статуса (71).Определяющая скорость стадия биосинтеза GSH включает глутамат-цистеинлигазу (GCL), которая может ингибироваться бутионин сульфоксимином (BSO) (72). Интересно, что мы наблюдали, что соотношение FCP-1 F зеленый / F оранжевый было выше в обработанных BSO клетках HeLa по сравнению с контрольными клетками (фиг.4 B ), что указывает на увеличение лабильных Уровни Cu (I) при блокировании синтеза GSH. Более того, общие уровни внутриклеточной меди существенно не различались между клетками, предварительно обработанными BSO, и контрольными клетками, как показывает ICP-MS (рис.4 C ), показывая, что динамические изменения происходят в лабильном пуле Cu (I), а не в общем увеличении или уменьшении общего пула меди. В целом, мы предостерегаем от чрезмерной интерпретации этих данных как подтверждающих простую и прямую модель комплексообразования Cu (I) -глутатион, поскольку, хотя было обнаружено, что водные растворы FCP-1 и Cu (I) показывают более высокие значения F 526 / F 576 соотношения при более низких концентрациях GSH in vitro ( SI Приложение , рис. S19), переменные значения констант диссоциации и стехиометрия медь-лиганд, полученные в различных буферных условиях, предполагают более сложное взаимодействие между металлами и путями окислительно-восстановительного гомеостаза (7 , 22, 73).В самом деле, GSH является не только восстановителем, но также сообщалось о взаимодействии с металло-шаперонами, такими как ATOX1, или белками, буферизующими / поглощающими металлы, такими как металлотионеин, с образованием комплексов, которые могут прочно связывать медь (73–76). Следовательно, наблюдаемое повышение уровня лабильного Cu (I) в результате дефицита GSH может действовать через более сложные, косвенные механизмы, область, которая требует дальнейшего изучения.

Для дальнейшего изучения корреляций между лабильными пулами Cu (I) и измененным метаболизмом GSH мы подготовили для исследования 2 клеточные линии MEF, где одна линия демонстрирует более низкие уровни общего GSH за счет стабильного генетического нокдауна эндогенного Gclc (каталитическая субъединица фермент, ограничивающий скорость GCL в синтезе GSH), а другая линия демонстрирует более низкие уровни GSH и более низкое отношение восстановленного GSH к окисленному (GSH / GSSG) за счет нокдауна глутатионредуктазы ( Gsr ; НАДФН-зависимый фермент, который расщепляет дисульфидной связи на 2 окисленных молекулах GSH) (71, 77).Как и ожидалось, опосредованный короткой шпилькой РНК (shRNA) нокдаун эндогенного Gclc (фиг.5, A и B ) значительно снижал уровни общего GSH в той же степени, что и MEF, обработанные BSO, что сильно ингибирует ферментативную функцию GCLC. , по сравнению с нецелевым контролем скремблирования ( Scr ) MEF (фиг. 5 C ). Важно отметить, что в этих нокдаун-клетках Gclc не наблюдается значительного изменения соотношения GSH / GSSG, несмотря на более низкие общие уровни GSH (рис.5 D ). Напротив, генетический нокдаун Gsr с помощью shRNA значительно снизил как общий уровень GSH, так и соотношение GSH / GSSG, тогда как обработка ингибитором GSR кармустином (бис-хлорэтилнитрозомочевиной, BCNU) только значительно снизила соотношение GSH / GSSH (рис. 5). C – F ), что указывает на колебания внутриклеточного окислительно-восстановительного баланса в сторону более окислительной среды при отсутствии способности регенерировать GSH из GSSG.

Рис. 5. Визуализация

FCP-1 показывает повышение или истощение пулов лабильных Cu (I), вызванное генетическими изменениями в общем глутатионе (GSH) или соотношении восстановленного / окисленного глутатиона (GSH / GSSG).( A ) Нормализованная экспрессия qPCR мРНК Gclc и ( B ) иммуноблот-определение GCLC или ACTIN в MEF, стабильно экспрессирующих ненаправленную контрольную shРНК ( Scr ) и Gclc shRNA. ( C и D ) Количественная оценка общего клеточного глутатиона (GSH, микромолярный) или отношения GSH к GSSG (GSH / GSSG) ± SEM из MEF, стабильно экспрессирующих Scr , Gclc shRNA, Gsr shRNA , или Scr , обработанные 1 мМ BSO или 0.1 мМ BCNU. Уровни GSH и GSH / GSSG определяли с использованием набора GSH / GSSG-Glo Assay, и результаты сравнивали с использованием однофакторного дисперсионного анализа с последующим тестом множественного сравнения Даннета ( n ≥ 11). ( E ) Экспрессия qPCR мРНК Gsr и ( F ) иммуноблот-определение GSR или ACTIN в MEF, стабильно экспрессирующих Scr и Gsr shRNA. ( G ) Репрезентативные конфокальные флуоресцентные изображения MEF, стабильно экспрессирующих Scr , Gclc shRNA или Gsr shRNA, инкубированных с FCP-1.( H ) Количественная оценка нормированной средней флуоресценции FCP-1 ( F зеленый / F оранжевый ) ± SEM. Данные взяты из анализа 98 отдельных клеток. ( I ) Предложенная модель изменений ферментов биосинтеза глутатиона и окислительно-восстановительного стресса на биодоступность лабильных пулов Cu (I). ( J ) Общие уровни Cu (частей на миллион, ppm), обнаруженные с помощью ICP-MS из MEF, стабильно экспрессирующих Scr , Gclc shRNA или Gsr shRNA на массу образца ± SEM ( n = 6) .Результаты сравнивали с использованием однофакторного дисперсионного анализа с последующим многократным сравнением Даннета. * P <0,05, ** P <0,01 и **** P <0,0001; нс, статистически не значимо.

После подтверждения успешной манипуляции либо уровнями GSH, либо соотношением GSH / GSSG, FCP-1 применяли для исследования относительных уровней лабильного Cu (I) в этой панели генетически определенных клеточных линий. Нокдаун клеток Gclc показал более высокое соотношение FCP-1 F зеленый / F оранжевый по сравнению с клетками Scr , в то время как более низкое FCP-1 F зеленый / F оранжевый соотношение наблюдалось в клетках с нокдауном Gsr по сравнению с контролем (рис.5 G и H ). Поскольку нокдаун Gclc ингибирует фермент, участвующий в определяющей скорости стадии биосинтеза GSH, и имитирует фармакологическое лечение BSO (рис. 4 B ), мы приписываем наблюдаемое увеличение F зеленый / F оранжевый соотношение к снижению общего уровня GSH. Минимальное изменение соотношения GSH / GSSG в этой линии клеток с нокдауном Gclc предполагает, что общее окислительно-восстановительное состояние клетки не затронуто, и вместо этого указывает на снижение уровней лабильных систем Cu (I) -буферирования (рис.5 I ). Включены потенциальные аддукты GSH-металло-шаперон или GSH-металлотионеин, оба из которых могут влиять на слабосвязанные пулы Cu (I) по сравнению с прочно связанными. С другой стороны, клетки с нокдауном Gsr показали более низкое соотношение GSH / GSSG (рис. 5 D ), что отражает более общую окислительную внутриклеточную среду и может привести к сдвигу в динамическом балансе Cu (I / II ) пулов, что приводит к снижению уровней лабильных Cu (I) (рис. 5 I ). Хотя общие уровни GSH также снижаются в клетках с нокдауном Gsr , что может в некоторой степени увеличивать биодоступность лабильного Cu (I), статистически значимое снижение соотношения FCP-1 F зеленый / F оранжевый относительно контроля указывает на общий лабильный дефицит Cu (I) и предполагает, что окислительно-восстановительный вклад большего количества GSSG по сравнению с GSH является доминирующим фактором.Поскольку механизм определения активности FCP-1 основан на кислородзависимой окислительно-восстановительной реакции с Cu (I), мы провели дополнительную серию контрольных экспериментов, используя ранее описанный медный флуоресцентный датчик включения, Copper Fluor-4 (CF4). , который действует по прямому обратимому механизму, основанному на связывании Cu (I) (14). CF4 показал повышенную флуоресценцию в линиях клеток с нокаутом Gclc , но уменьшил флуоресценцию в клетках с нокаутом Gsr , что хорошо согласуется с результатами, полученными с FCP-1 ( SI Приложение , рис.S20), обеспечивая дополнительную поддержку изменений в лабильных пулах Cu (I), вызванных изменениями в статусе GSH и GSH / GSSG. Наконец, в то время как пулы лабильных Cu (I) изменяются в MEF, в которых отсутствуют Gclc или Gsr , никаких изменений в общем содержании меди при измерении с помощью ICP-MS не наблюдалось (фиг. 5 J ). Эти эксперименты показывают, что лабильные пулы Cu (I) могут увеличиваться и / или истощаться глутатион-зависимым образом в зависимости как от общего уровня GSH, так и от окислительно-восстановительных соотношений GSH / GSSG.

Онкогенные мутации BRAF

V600E и KRAS G12 приводят к лабильному дефициту Cu (I) отчасти из-за пониженной экспрессии GSR и пониженной способности регенерировать GSH.

Отметив растущие связи между сигнальными путями меди и киназы, участвующими в онкогенезе, мы затем попытались применить идентификацию перекрестного взаимодействия медь-глутатион к онкогенезу. Действительно, быстрое размножение, связанное с онкогенезом, требует, чтобы раковые клетки увеличивали энергетический метаболизм и запускали клеточные механизмы для ответа на онкогенный стресс, чтобы поддерживать неограниченный рост опухоли, выживаемость и терапевтическую резистентность.Например, многие солидные опухоли демонстрируют повышенную продукцию активных форм кислорода (АФК) в ответ на более высокие энергетические потребности и дисфункцию митохондрий. В результате это вызывает антиоксидантную программу по детоксикации от АФК и поддержанию более надежного окислительно-восстановительного баланса (78). Например, MEF, экспрессирующие условные онкогенные аллели KRAS G12D или BRAF V619E , демонстрируют пониженные уровни внутриклеточных ROS с сопутствующим увеличением экспрессии мРНК генов метаболизма глутатиона Gclc и Gclm (79).Более того, эктопическая экспрессия KRAS G12D увеличивает общий уровень GSH, но снижает соотношение GSH / GSSG. Однако остается недостаточно ясным, изменяют ли онкогенные мутации в BRAF или KRAS внутриклеточные пулы лабильной Cu (I), нарушая внутриклеточный окислительно-восстановительный баланс, особенно через глутатионовые пути.

Чтобы ответить на этот вопрос, иммортализованные MEF были трансформированы с помощью BRAF V600E или KRAS G12D , а уровни внутриклеточной лабильной Cu (I) были оценены с помощью ратиометрической визуализации FCP-1.Интересно, что мы наблюдали снижение средней ратиометрической флуоресценции клеток MEF, трансформированных как BRAF V600E , так и KRAS G12D , по данным FCP-1 F зеленый / F оранжевый соотношение по сравнению с контрольные конгенеры (рис.6 A и B ). Эти результаты были фенокопированы в экспериментах по визуализации живых клеток с использованием комплементарного зонда CF4, что позволяет предположить, что свободно связанные пулы внутриклеточной Cu (I) уменьшаются при онкогенной трансформации ( SI Приложение , рис.S21 A и B ). В соответствии с этим мы обнаружили, что стабильность белка CCS, который деградирует зависимым от Cu образом, повышается в клетках, стабильно экспрессирующих эти онкогены, или когда клетки обрабатывают хелатором Cu BCS в качестве положительного контроля, что свидетельствует об истощении лабильных внутриклеточных Cu бассейны (рис.6 C ). Чтобы определить, отражается ли наблюдаемый лабильный дефицит Cu (I), обнаруженный с помощью визуализации живых клеток FCP-1 и CF4, на изменениях общего клеточного уровня Cu, ICP-MS выполняли для контроля, BRAF V600E — или KRAS . G12D -экспрессирующие MEF, и эти клетки показали неизменные уровни общей Cu (рис.6 D ), подтверждая, что выборочно изменяется лабильный пул Cu (I), а не общий пул Cu. Кроме того, уровни транскрипта Ctr1 как в клетках BRAF V600E , так и в клетках KRAS G12D остаются аналогичными контрольным клеткам, что позволяет предположить, что наблюдаемое снижение лабильных уровней Cu (I) не связано с изменениями в импорте Cu в клетки (рис. E ). Хотя уровни транскрипта Atp7a были незначительно ниже как в клетках BRAF V600E , так и в клетках KRAS G12D (рис.6 F ), эти изменения в экспрессии мРНК Atp7a могут отражать клетки, чувствительные к более низким уровням биодоступности Cu (I). В качестве альтернативы дифференциальной экспрессии транспортеров Cu CTR1 и ATP7A для снижения уровней лабильного Cu (I) недавние исследования установили, что снижение уровней CTR1 или введение поверхностно доступных мутаций в MEK1, который функционирует ниже онкогенного BRAF V600E , как подход к нарушению связывания Cu уменьшал BRAF V600E -управляемую передачу сигналов и рост опухоли (5, 80).Таким образом, взаимодействие Cu-MEK1 / 2 необходимо для передачи сигналов и туморогенеза, управляемых BRAF V600E , а снижение уровня лабильной Cu в MEF, трансформированных BRAF V600E , потенциально может быть вызвано увеличением доставки Cu в MEK1 / 2 для поддержки гиперактивированных Передача сигналов митоген-активируемой протеинкиназы. Чтобы экспериментально рассмотреть эту возможность, MEF, трансформированные BRAF V600E , были сконструированы для стабильной экспрессии скремблирующей shРНК или Mek1 shRNA с РНК-опосредованной интерференционной устойчивой MEK1 дикого типа или Cu-связывающего мутанта MEK1 (MEK1 CBM ). и ратиометрическую флуоресценцию от FCP-1 в этих клеточных линиях сравнивали с нетрансформированными MEF.В то время как экспрессия BRAF V600E снижала F зеленый / F оранжевый на ∼20%, снижение сохранялось в присутствии как MEK1 дикого типа, так и MEK1 CBM , предполагая, что наблюдаемое снижение лабильный пул Cu (I) не зависит от связывания MEK1 / 2 Cu ( SI, приложение , фиг. S22).

Рис. 6.

Онкогенный BRAF V600E и KRAS G12D приводят к снижению лабильных пулов Cu (I) за счет снижения уровней Gsr и увеличения экспрессии CCS.( A ) Репрезентативная ратиометрическая визуализация живых клеток FCP-1 на MEF, стабильно экспрессирующих не нацеливающую контрольную shРНК ( Scr ), BRAF V600E кДНК или KRAS кДНК G36 G12D 90. ( B ) Количественная оценка средней флуоресценции FCP-1 ( F зеленый / F оранжевый ) ± SEM от MEF, стабильно экспрессирующих Scr , BRAF V600E cDNA G12D кДНК.Результаты сравнивали с использованием однофакторного дисперсионного анализа с последующим многократным сравнением Даннета. Данные взяты из анализа 105 или более отдельных ячеек. ( C ) Обнаружение иммуноблотом CCS или ACTIN в MEF, стабильно экспрессирующих Scr , BRAF V600E кДНК или KRAS G12D кДНК или кДНК Scr , обработанных Scr. Количественное определение: ΔCCS / ACTIN, нормализованное до Scr . Результаты 3 независимых биологических повторов сравнивали с использованием непарного теста t .( D ) Количественная оценка средних уровней Cu (частей на миллион, ppm), обнаруженных с помощью ICP-MS для MEF, стабильно экспрессирующих Scr , BRAF V600E кДНК или KRAS G12D на массу образца ± SEM ( n = 5). Результаты сравнивали с использованием однофакторного дисперсионного анализа с последующим многократным сравнением Даннета. ( E и F ) Экспрессия qPCR мРНК Ctr1 или Atp7a из MEF, стабильно экспрессирующих Scr , BRAF V600E кДНК или кДНК G35367 KRAS .( п, = 4). Результаты сравнивали с использованием однофакторного дисперсионного анализа с последующим многократным сравнением Даннета. ( G и H ) Количественная оценка общего клеточного глутатиона (GSH, мкМ) или отношения GSH к GSSG (GSH / GSSG) ± SEM из MEF, стабильно экспрессирующих Scr , BRAF V600E кДНК , или KRAS G12D кДНК. Результаты сравнивали с использованием однофакторного дисперсионного анализа с последующим тестом множественного сравнения Даннета ( n, ≥ 11).Данные взяты из 4 биологических повторностей, проведенных в трех повторностях. ( I и J ) Экспрессия qPCR мРНК Gclc или Gsr из MEF, стабильно экспрессирующих Scr , BRAF V600E кДНК или кДНК K353 KRAS . Результаты сравнивали с использованием однофакторного дисперсионного анализа с последующим тестом множественного сравнения Даннета ( n = 4). Данные взяты из 4 биологических повторностей, проведенных в трех повторностях.( K ) Обнаружение иммуноблотом GCLC, GSR или ACTIN в MEF, стабильно экспрессирующих Scr , BRAF V600E кДНК или KRAS G12D кДНК. Количественное определение: ΔGCLC / ACTIN или ΔGSR / ACTIN, нормализованные до Scr . Результаты 3 независимых биологических повторов сравнивали с использованием непарного теста t . ( L ) Анализ проточной цитометрии уровня ROS, количественно определяемый средней интенсивностью флуоресценции CellROX Green ± SEM для MEF, стабильно экспрессирующих Scr , BRAF V600E кДНК или KRAS

    кДНК.Результаты сравнивали с использованием однофакторного дисперсионного анализа с последующим тестом множественного сравнения Даннета ( n ≥ 11). * P <0,05, ** P <0,01 и **** P <0,0001; нс, статистически не значимо. ( M ) Предполагаемые эффекты онкогенной активации BRAF V600E или KRAS G12D на биодоступность лабильных пулов Cu (I).

    Учитывая наши коллективные результаты, которые показывают, что Cu (I) кажется менее биодоступным в контексте онкогенной трансформации, мы предположили, что различия в метаболизме глутатиона могут быть движущей силой фенотипа.С этой целью мы протестировали общие уровни GSH и отношения GSH / GSSG в MEF, трансформированных онкогенным BRAF V600E или KRAS G12D , и обнаружили, что экспрессия любого из онкогенов увеличивает общие уровни GSH, хотя статистически значимо только в KRAS G12D. ячеек (рис.6 G ). К нашему удивлению, отношения GSH / GSSG были значительно ниже в BRAF V600E и KRAS G12D , стабильно экспрессирующих MEF, по сравнению с контрольными клетками (фиг. 6 H ).Поскольку MEF, трансформированные BRAF V600E и KRAS G12D , фенокопировали генетический нокдаун Gsr в отношении пониженной ратиометрической флуоресценции от FCP-1 и уменьшенного отношения GSH / GSSG, уровни мРНК Gsr и экспрессия белка были допросили. При нормализации к контрольным клеткам уровни транскриптов Gsr были значительно снижены при стабильной экспрессии либо BRAF V600E , либо KRAS G12D , тогда как уровни транскриптов Gclc остались относительно неизменными среди них (рис.6 I и J ). Параллельно с уровнями транскрипта Gsr экспрессия белка GSR снижалась в клетках BRAF V600E и KRAS G12D по сравнению с контрольными клетками (фиг. 6 K ). Напротив, уровни белка GCLC были выше в клетках BRAF V600E и KRAS G12D по сравнению с контрольными клетками (фиг. 6 K ). Чтобы еще больше подтвердить связь между онкогенезом, гомеостазом меди и изменениями экспрессии фермента метаболизма глутатиона, как BRAF V600E , так и KRAS G12D значительно увеличили уровни зеленой флуоресценции CellROX (рис.6 L ), предполагая, что онкогенная трансформация увеличивает ROS и, в свою очередь, снижает лабильный пул Cu (I). Из этих данных мы заключаем, что клетки, трансформированные BRAF V600E и KRAS G12D , демонстрируют лабильный дефицит Cu (I), частично из-за снижения уровней Gsr и повышенных уровней ROS, которые оба могут способствовать более окисленному клеточная среда из-за неспособности регенерировать GSH (рис. 6 M ).

    Заключительные замечания

    Сложное и динамическое взаимодействие между лабильными и совокупными пулами металлов имеет значение для гомеостаза металлов и нарушения регуляции металлов в здоровом и болезненном состояниях.Медь является ярким примером этой дихотомии сигнал / стресс, поскольку ее мощная окислительно-восстановительная активность делает ее важным питательным веществом, но такая же химическая реакционная способность делает потерю гомеостаза меди опасностью для окислительно-восстановительного баланса клетки. Чтобы удовлетворить потребность в новых химических инструментах для исследования лабильных пулов меди, которые будут использоваться в сочетании с дополнительными традиционными методами для определения общего состояния меди, мы разработали FCP-1, ратиометрический датчик FRET первого поколения, основанный на активности, который обеспечивает выборочную визуализацию лабильных Cu (I) объединяется в живых клетках с самокалибрующейся реакцией.FCP-1 использует классический мотив биоинорганического лиганда TPA для Cu (I) -зависимого расщепления, чтобы регулировать FRET между донорными единицами флуоресцеина и акцепторами родамина в зависимости от дозы, обеспечивая высокую специфичность к металлу и степени окисления для Cu (I). Благодаря своей логометрической реакции, FCP-1 способен визуализировать динамические изменения в уровнях лабильного Cu (I) в живых клетках с добавлением меди и / или хелатированием, а также отслеживать снижение уровня эндогенного лабильного Cu (I) в клетках с дефицитом MEF. в транспортере меди CTR1.Действительно, ратиометрическое считывание FCP-1 с внутренней самокалибровкой двух эмиссионных сигнатур является ключевым отличительным признаком для мониторинга базальных уровней лабильной Cu (I) в разных клеточных линиях, так как контрольный зонд FL-TPA, который использует тот же триггер на основе активности, но реагирует только в режиме интенсивности при 1 считывании выбросов, не может различить лабильный статус Cu (I) между линиями CTR1 дикого типа и нокаутными линиями CTR из-за вариабельности загрузки зонда.

    На этом фоне мы применили FCP-1 для визуализации изменений в лабильных пулах Cu (I) в условиях окислительно-восстановительного стресса, уделяя особое внимание связи между гомеостазом меди и глутатиона.Действительно, мы наблюдали повышенные уровни лабильной Cu (I) в клетках с нокдауном Gclc , которые обладают меньшим количеством общего GSH по сравнению с соответствующими контролями дикого типа, тогда как мы обнаружили более низкие уровни лабильной Cu (I) в Gsr нокдаун клеток относительно контрольных конгенеров. Эти данные визуализации отслеживают значительное снижение отношения GSH / GSSG в клетках с нокдауном Gsr , но не в клетках с нокдауном Gclc . Более того, мы идентифицировали снижение соотношения GSH / GSSG в MEF, трансформированных онкогенным BRAF V600E или KRAS G12D , что, в свою очередь, вызывает лабильный дефицит Cu (I).В сочетании с тем фактом, что общие уровни меди остаются неизменными в линиях нокдауна Gclc или Gsr и онкогенных клеточных линиях BRAF V600E или KRAS G12D , и что мы также наблюдаем более высокую экспрессию белка CCS, который может прочно связывать медь и более низкие уровни лабильной Cu (I), ратиометрические измерения флуоресценции FCP-1 показывают, что на пул лабильных Cu (I) избирательно влияет трансформация онкогенов по всему пулу меди. Выявив связи между пулом лабильных Cu (I), метаболизмом глутатиона и онкогенными трансформациями, эта работа обеспечивает отправную точку для дальнейшего изучения того, как и почему снижение лабильных уровней Cu (I) может способствовать развитию и прогрессированию рака.Наконец, это исследование мотивирует разработку сенсорных зондов на основе активности для ратиометрического обнаружения более широкого набора целевых аналитов в биологических условиях, где самокалибровка может оказаться полезной.

    Биосенсор на основе FRET для количественного определения глюкозы в культуральных супернатантах при культивировании микробов в миллилитровом масштабе | Фабрики микробных клеток

    Характеристики сенсора

    Концентрация d-глюкозы при культивировании микробов обычно находится в диапазоне от 0 до 200 мМ, что требует сравнительно низкого сродства сенсора d-глюкозы в нижнем миллимолярном диапазоне для определения истощения d-глюкозы.Первый вариант растворимого сенсора, Glu [-] , изучаемый в этой работе, показывает K d -значения 0,4 ± 0,1 мМ для d-глюкозы и очень хорошую чувствительность в буфере, что можно вывести из соотношения FRET. изменение (ΔR) 75% между несвязанным и связанным состояниями (дополнительный файл 1: рисунок S1). Таким образом, диапазон обнаружения в буфере MOPS составляет от 0,01 мМ до 10 мМ (от 0,0018 г л -1 до 1,8 г л -1 ) d-глюкозы.

    Помимо высокой интенсивности сигнала датчик также должен быть стабильным в условиях микробиореактора, где биосенсор подвергается воздействию температуры и механической нагрузки из-за встряхивания.Во-первых, термостойкость сенсора растворимого Glu [-] была протестирована на предмет его стабильности при различных температурах. В то время как соотношение FRET в присутствии и в отсутствие d-глюкозы оставалось стабильным в течение 21 дня инкубации при 4 ° C и -20 ° C, соответственно, соотношение FRET уже явно изменилось через 3 дня при 25 ° C (рис. 1а), что явно ограничивает применимость этого датчика при комнатной температуре. Таким образом, сеньор подходит для применения в лабораторных условиях со временем культивирования в диапазоне от 24 до 48 часов.Анализ SDS-PAGE показал, что наблюдаемая нестабильность вызвана главным образом возрастающей деградацией слитого белка (рис. 1b). Белок биосенсора распадается на фрагменты размером около 30 кДа (рис. 1b, красный прямоугольник), которые соответствуют размерам как FP, так и центрального MglB, соответственно. Аналогичные результаты были получены и ранее при попытках кристаллизации разных аналогичных сенсоров (данные не показаны). Однако лежащий в основе механизм еще предстоит выяснить.

    Рис. 1

    Стабильность сенсора Glu [-] (20 мкМ) в буфере MOPS (20 мМ, pH 7.3) при 25 ° С. — соотношение FRET датчика Glu [-] , демонстрирующее явное свидетельство деградации после инкубации в течение 3 дней. b Анализ SDS-PAGE датчика Glu [-] . Ярлыки над дорожками обозначают количество дней инкубации. Размер полноразмерного белка составляет ~ 90 кДа (зеленая рамка). Через 2 дня при 25 ° C сенсор начинает распадаться на более мелкие фрагменты ~ 60 кДа (оранжевая рамка, дорожка 3) и ~ 25–30 кДа (красная рамка). Через 4 дня (дорожки 4–11) датчик полностью распадается на фрагмент ~ 25–30 кДа (подробности см. В тексте)

    Помимо температуры, датчик должен быть устойчивым также по отношению к различным средам культивирования.Чтобы тщательно протестировать применение нового сенсора d-глюкозы для применения с Corynebacterium glutamicum , среда CGXII была протестирована как типичная среда культивирования [30] на предмет влияния на свойства сенсора. Соответствующая изотерма связывания сенсора Glu [-] , записанная в присутствии культуральной среды, демонстрирует сильное влияние среды CGXII на чувствительность сенсора относительно буфера (см. Дополнительный файл 1: Рисунок S2). Из-за сильного фона и гашения среды CGXII измерения приемлемы только для среды CGXII, разбавленной как минимум 95% буфером (об. / Об.).Кроме того, это разведение позволяет проводить измерения в присутствии клеток C. glutamicum . Таким образом, разделение клеток перед измерением d-глюкозы на линии не требуется. К счастью, среда не повлияла на кажущийся K d варианта сенсора, что указывает на то, что гасящий эффект среды влияет на флуоресцентные белки, а не на MglB (дополнительный файл 1: Рисунок S2). Пределы обнаружения от 0,01 мМ до 10 мМ (от 0,0018 г л -1 до 1,8 г л -1 ) d-глюкозы, однако, можно смещать путем разбавления образцов культивирования.Разбавление в 40 раз позволило бы количественно определить d-глюкозу от 0,4 мМ до 400 мМ (от 0,072 до 72 г л -1 ), что охватывает диапазон концентраций большинства культивирований микробов.

    Еще одним предварительным условием для применения таких датчиков является воспроизводимость калибровок во время типичного эксперимента по выращиванию, указывающая на их стабильность в условиях процесса. Повторные сравнительные калибровки в буфере MOPS в присутствии и в отсутствие среды CGXII (2,5% об. / Об., Разведение 1:40) не показали значительного влияния на кажущееся сродство (K d ) и интенсивность сигнала Glu [-] датчик.Как показано на рис. 2, изотермы связывания оставались стабильными в течение всего эксперимента, демонстрируя, что этот датчик может использоваться для повторных измерений.

    Рис. 2

    Изотерма связывания биосенсора Glu [-] в любом MOPS (20 мМ, pH 7,3) ( a ) со средой CGXII (2,5% об.) И ( b ) без добавление среды без встряхивания. FRET-соотношение (I A / I D ) было рассчитано из эмиссий донора mTurquoise2 на 485 нм (± 20 нм) и акцептора Венеры на 528 нм (± 20 нм) после возбуждения донора на 428 нм. нм (± 9 нм) согласно формуле.(1). Между измерениями датчик хранился в защищенном от света месте при температуре 4 ° C. Кривые (пунктирные) были подогнаны к данным в соответствии с формулой. (2)

    Помимо термического разложения и воздействия среды, также встряхивание датчика Glu [-] в цветочных пластинах ® устройства BioLector ® оказалось вредным, поскольку излучение обоих FRET-партнеров значительно снизилось (см. Дополнительный файл 1: Рисунок S5). Уменьшение обеих интенсивностей излучения указывает на деградацию по крайней мере донора и, скорее всего, также акцептора.Кроме того, частота встряхивания> 800 об / мин приводила к агрегированию датчика Glu [-] (данные не показаны). Агрегированный сенсор больше не реагировал на изменения концентрации d-глюкозы, что делало сенсор Glu [-] непригодным для онлайн-применения во встряхиваемых культурах. Однако растворимый сенсор Glu [-] может применяться в автоматизированном процессе для измерения d-глюкозы на линии. При такой настройке запас биосенсора можно легко хранить при температуре 4 ° C между измерениями, что значительно увеличивает срок его службы.Кроме того, датчик Glu [-] не будет подвергаться тряске, что способствует стабильности датчика.

    Прямое нанесение растворимого сенсора Glu

    [-]

    При наличии достаточно стабильного сенсора и воспроизводимой калибровки был разработан поточный протокол количественного определения d-глюкозы для широко используемого производственного штамма Corynebacterium glutamicum (см. Дополнительный файл 1: Рисунок S7). Во время выращивания C. glutamicum ATCC 13032 в BioLector ® рост биомассы, потребление кислорода и изменения pH отслеживали в режиме онлайн.Как описано в разделе «Методы», каждый час с помощью системы обработки жидкости отбирали три образца, разбавляли и измеряли концентрацию d-глюкозы с помощью биосенсора Glu [-] (см. Дополнительный файл 1: Рисунок S8 для калибровки). Супернатант оставшихся образцов хранили при 4 ° C для сравнительной автономной аналитики с использованием ВЭЖХ и ферментативного анализа d-глюкозы [2].

    Как показано на рис. 3, сенсорный анализ Glu [-] работал очень хорошо и отражал потребление d-глюкозы в соответствии с анализами ВЭЖХ и ферментативного анализа.Примечательно, что измерение проводилось в присутствии бактериальных клеток с использованием небольшого количества образца (15 мкл) и очень короткого времени инкубации (<1 мин). Эти свойства облегчают быстрый процесс измерения, и, таким образом, наш рабочий процесс позволяет количественно определять d-глюкозу в большом количестве образцов во время выполнения процесса культивирования.

    Рис. 3

    Рост биомассы ( a ) и потребление d-глюкозы C. glutamicum ATCC 13032 в среде CGXII с последующим использованием ( b ) сенсора Glu [-] ( c ) ферментативный анализ d-глюкозы и ( d ) анализ ВЭЖХ.В то время как сенсорный анализ можно было проводить в режиме реального времени, ферментативные анализы и анализы ВЭЖХ проводились в автономном режиме после завершения культивирования. Каждая кривая напоминает биологическую копию. Планки погрешностей представляют собой стандартное отклонение (SD) в трех технических повторностях

    .

    Ферментативные анализы обычно используются для количественного определения d-глюкозы в образцах микробных культур [2, 3], а также могут использоваться в автоматизированной поточной установке [33]. Однако есть ярко выраженные недостатки: во-первых, они требуют предварительного отделения бактериальных клеток, часто с помощью центрифугирования или фильтрации.Это усложняет рабочий процесс, отнимает больше времени и требует сложной платформы для обработки жидкостей. Напротив, для сенсорного анализа d-глюкозы требуются только этапы разбавления, которые можно быстро выполнить с помощью стандартных операций с жидкостью. Во-вторых, ферментные анализы включают этапы инкубации от 10 мин [34] до 30 мин [2]. Хотя этот трудоемкий этап не вызывает проблем при параллельной обработке большого количества выборок, он ограничивает интервал измерений на линии. Например, предыдущее исследование продемонстрировало измерение d-глюкозы на линии с помощью ферментативного анализа с 80-минутными интервалами [33].С другой стороны, биосенсор Glu [-] немедленно реагирует на d-глюкозу в окружающей среде, в том числе в присутствии клеток, что открывает путь к очень коротким циклам измерения и, таким образом, увеличивает плотность данных.

    Насколько нам известно, в настоящее время не существует метода поточной ВЭЖХ, разработанного для микробиореакторов из-за длительного времени удерживания и иногда сложной подготовки образцов [35]. Несмотря на то, что подготовку проб путем фильтрации можно легко автоматизировать, недостаток измерения только одного образца за раз серьезно препятствует применению методов ВЭЖХ на линии при культивировании в микробиореакторах, которые часто включают несколько параллельных культивирований.Однако хроматографические методы имеют преимущество измерения нескольких аналитов за один прогон.

    Иммобилизация

    После успешной настройки протокола измерения на линии в среде CGXII, мы остановились на приложении для онлайн-измерений. Как показано выше, растворимый сенсор Glu [-] не обладает долговременной стабильностью при температурах выше 25 ° C и подвержен механическим воздействиям. Нельзя избежать механического стресса, так как перемешивание необходимо для любого микробного культивирования, чтобы гарантировать достаточное перемешивание и, в случае аэробных культивирований, перенос кислорода.Таким образом, стабильность датчика должна быть улучшена. Первоначальные исследования иммобилизации с помощью His-tag не увенчались успехом, поскольку хелатная связь Co 2+ с гранулами диоксида кремния, функционализированными нитрилотриуксусной кислотой (Dynabeads, ThermoScientific), не была стабильной в условиях процесса (данные не показаны). Альтернативным подходом является иммобилизация с помощью HaloTag ® [21], который обеспечивает ковалентную иммобилизацию и очистку в одну стадию, начиная с непосредственно неочищенных клеточных экстрактов, что недавно было успешно продемонстрировано для иммобилизации различных ферментов [22, 36, 37 ].

    Слияние HaloTag ® с C-концом сенсора d-глюкозы привело к сенсору Glu [+ Halo] . Это слияние уменьшило общее соотношение FRET, а также ΔR в растворе с 75% до почти 40% по сравнению с датчиком Glu [-] . Однако после иммобилизации датчик Glu [+ Halo] восстанавливает функциональность и высокую интенсивность сигнала (ΔR 74%) датчика Glu [-] (подробности см. В дополнительном файле 1: Рисунок S1). Этот удивительный результат можно объяснить следующим образом: как мы показали ранее, эффективность FRET (интенсивность сигнала) сильно зависит от расстояния и гибкости донорного FP mTurquoise2 относительно центрального связывающего глюкозу белка (MglB) [20].Из-за аналогичного размера FP и HaloTag ® (около 30 кДа) нельзя исключить отрицательные стерические эффекты C-концевого HaloTag ® в растворимой рецептуре сенсора, что могло бы объяснить снижение общей эффективности переноса, как показано в спектрах излучения (рис. 4). Здесь пониженная эффективность переноса отражается в уменьшении излучения акцепторной Венеры после возбуждения донора mTurquoise2 (λ ex = 425 ± 9 нм). Поскольку HaloTag ® расположен на С-конце сенсора, белок, вероятно, искажается, тем самым изменяя расстояние и / или ориентацию между донором и акцептором.Иммобилизация на поверхности шариков Sepharose ® , по-видимому, снижает взаимодействие HaloTag ® с партнерами FRET, что приводит к восстановлению функциональности. Примечательно, что на аффинность (K d ) датчика не влияет ни добавление метки, ни иммобилизация. В растворимом составе, а также в иммобилизованной форме сродство оставалось в том же диапазоне (0,8 мМ ± 0,2 мМ), что указывает на то, что HaloTag ® не влияет на сайт связывания d-глюкозы (дополнительный файл 1: Рисунок S1).

    Рис. 4

    Спектры излучения датчика Glu [+ Halo] ( a ) не иммобилизованного и ( b ) иммобилизованного на смоле HaloLink ® . Спектры получали после возбуждения FRET-донора mTurquoise2 при λ ex = 425 нм (± 9 нм) в присутствии (черная кривая) и отсутствии (серая кривая) 1 М d-глюкозы. Интенсивности нормированы на излучение при 485 нм (λ em mTurquoise2)

    По сравнению с другими методами иммобилизации для таких датчиков, такими как инкапсуляция, сайт-ориентированная иммобилизация с помощью HaloTag ® не превосходит ни гибкость, ни отрицательно сказывается доступность обездвиженного датчика.В предыдущем исследовании аналогичный датчик d-глюкозы на основе FRET был инкапсулирован в частицы кремнезема, что значительно снизило интенсивность FRET [38]. Кроме того, биосенсор может быть иммобилизован непосредственно из неочищенного клеточного экстракта, что позволяет избежать трудоемкой и дорогостоящей хроматографической очистки белка [39].

    Онлайн-применение иммобилизованного сенсора Glu

    [+ Halo]

    С сенсором Glu [+ Halo] , ковалентно иммобилизованным на поверхности шариков сефарозы ® , устойчивость сенсора к механическим воздействиям была значительно увеличена , что было предварительным условием для применения этих шариков непосредственно при культивировании микробов (дополнительный файл 1: Рисунок S6).Хотя иммобилизация решает проблемы стабильности, тушение среды CGXII остается. Кроме того, увеличение концентрации C. glutamicum также приводит к увеличению фона из-за аутофлуоресценции [40]. Чтобы преодолеть это, иммобилизованный сенсор Glu [+ Halo] был протестирован в среде M9, типичной среде для культивирования Escherichia coli [32]. Несмотря на снижение ΔR до 35%, изменение отношения FRET заметно (см. Дополнительный файл 1: Рисунок S3).Как следствие, измерения в среде M9 можно проводить с датчиком непосредственно в культивировании, что упрощает онлайн-приложение.

    Результаты онлайн-применения иммобилизованного сенсора Glu [+ Halo] во время культивирования E. coli K12 MG1655 в среде M9 показаны на рис. 5. На протяжении всего культивирования отслеживались оба флуоресцентных сигнала сенсора. с помощью BioLector ® и был рассчитан FRET-коэффициент (I A / I D ).Затем была рассчитана внеклеточная концентрация d-глюкозы на основе отношения FRET и калибровки иммобилизованного сенсора Glu [+ Halo] в той же среде в той же цветочной пластине (см. Дополнительный файл 1: Рисунок S9 для калибровки). . За потреблением d-глюкозы можно было следить в течение всего эксперимента по культивированию (20 ч). Здесь датчик Glu [+ Halo] имел диапазон обнаружения от 0,02 до 2 мМ (от 0,0036 до 0,36 г л -1 ). В соответствии с этим диапазоном после истощения d-глюкозы (через 18 ч) дальнейшее изменение сигнала FRET не могло быть обнаружено.Несмотря на то, что в среде не осталось d-глюкозы, биомасса еще больше увеличилась, предположительно в результате избыточного метаболизма [41].

    Рис. 5

    FRET-отношение ( a ), истощение глюкозы ( b ) и рост биомассы ( c ) при культивировании E. coli в среде M9, измеренные с помощью иммобилизованного биосенсора на основе FRET на смоле HaloLink ® . Коэффициент FRET использовался для расчета текущей концентрации d-глюкозы на основе калибровки иммобилизованного сенсора (см. Дополнительный файл 1: Рисунок S9)

    Преимущество онлайн-измерения согласуется с недостатком ограничения определенным измерительным окном, определяемым динамическим диапазоном датчика.В отличие от измерений на месте, где конечная концентрация d-глюкозы в образцах может быть адаптирована к сродству сенсора, для онлайн-измерений требуются либо сенсоры с более широким динамическим диапазоном, либо другие сенсоры с соответствующим сродством, чтобы охватить более широкий диапазон концентраций целевого метаболита. . Сродство сенсора d-глюкозы можно регулировать либо соответствующей аминокислотной заменой в связывающих глюкозу белках [24, 42, 43], выбирая альтернативные связывающие глюкозу белки с более низким сродством [44, 45], либо вставляя линкер. последовательности [9, 20].Поскольку до сих пор не известен сенсор на основе FRET с очень широким диапазоном обнаружения [7], комбинация нескольких сенсоров d-глюкозы с разным сродством и пар FRET, иммобилизованных на одном носителе, может рассматриваться как расширение диапазона обнаружения.

    Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно.Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом.Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    CRISPR / двойной FRET молекулярный маяк для чувствительной визуализации живых клеток неповторяющихся локусов генома | Исследование нуклеиновых кислот

    Аннотация

    Кластерные системы геномной визуализации на основе регулярных промежуточных коротких палиндромных повторов (CRISPR) в основном полагаются на флуоресцентные белковые репортеры, у которых отсутствуют оптические свойства, необходимые для чувствительной динамической визуализации.Здесь мы модифицировали однонаправленную РНК CRISPR (sgRNA), чтобы нести два различных молекулярных маяка (MB), которые могут подвергаться резонансной передаче энергии флуоресценции (FRET), и продемонстрировали, что полученная система CRISPR / dual-FRET MB позволяет динамическое отображение неповторяющиеся геномные локусы всего с тремя уникальными sgRNA.

    ВВЕДЕНИЕ

    Деактивированный нуклеазой мутант кластерного белка 9, ассоциированного с короткими палиндромными повторами (CRISPR) с регулярными интервалами (CRISPR), сохраняет способность связываться с конкретным целевым геномным локусом посредством ассоциации с родственной Cas9 однонаправленной РНК (sgRNA), тем самым стимулируя развитие разработка основанных на CRISPR подходов для неинвазивной геномной визуализации (1–10).Однако в большинстве подходов использовались dCas9 или sgRNA, модифицированные для переноса флуоресцентных белков (FP), которым не хватает яркости и фотостабильности, необходимых для непрерывной визуализации. Органические красители (флуорофоры), по сравнению с ФП, обычно более яркие и светостойкие. Кроме того, флуоресценция многих флуорофоров может быть значительно снижена, если они расположены в непосредственной близости от совместимого гасителя. Соответственно, были разработаны различные флуорогенные зонды на основе пар флуорофор-гаситель, чтобы обеспечить обнаружение конкретных биомолекул в живых клетках без необходимости смывать несвязанные зонды.Одним из широко используемых флуорогенных зондов является молекулярный маяк (MB) (11), класс олигонуклеотидных зондов, образующих петлю и стволовых, содержащих флуорофор и гаситель на двух концах, который широко использовался для визуализации РНК живых клеток (12–12). 14). Перед активацией МБ проявляют слабый сигнал флуоресценции, поскольку комплементарные последовательности коротких плеч на двух концах самоотжигаются с образованием стабильного дуплекса ствола, который удерживает флуорофор и гаситель в непосредственной близости. Гибридизация РНК-мишени с доменом петли разрушает дуплекс ствола, что приводит к отделению гасителя от флуорофора для восстановления флуоресценции MB.

    Признавая полезность sgRNAs для геномного мечения и полезные флуорогенные свойства MB при гибридизации РНК, наша лаборатория недавно объединила системы CRISPR и MB для создания платформы геномной визуализации под названием CRISPR / MB (9), которая состоит из dCas9, MB и sgRNA, сконструированная так, чтобы нести уникальную последовательность-мишень MB, не обнаруженную в геноме человека (MTS). Чтобы осветить конкретный геномный локус, сначала коэкспрессируют dCas9 и модифицированную sgRNA для нацеливания на локус в клетках, после чего следует доставка MB, которые после гибридизации с MTS могут освещать целевой локус.Посредством визуализации повторяющихся элементов внутри теломер мы продемонстрировали, что CRISPR / MB более эффективен и чувствителен, чем традиционные подходы, использующие белки, связывающие повторы теломер, слитые с FP. В этом исследовании мы стремились дополнительно усовершенствовать систему CRISPR / MB путем модификации sgRNA, чтобы она содержала две различные целевые последовательности MB (sgRNA_dual-MTS) для двух разных MB, флуорофоры которых образуют пару флуоресцентного резонансного переноса энергии (FRET) (рисунок 1). , стратегия, названная MB с двойным FRET (15,16).Поскольку FRET возникает только тогда, когда два MB гибридизуются с одной и той же РНК, предполагается, что MB с двойным FRET избегают фоновых сигналов, возникающих в результате несовершенного тушения и неспецифического связывания с белками отдельных MB. Были проведены специальные эксперименты для оценки возможностей предлагаемой нами системы, названной CRISPR / dual-FRET MB, для визуализации живых клеток неповторяющихся областей в геномных локусах с использованием широкопольной флуоресцентной микроскопии.

    Рисунок 1.

    Схема CRISPR / dual-FRET MB для маркировки определенного локуса.Чтобы осветить конкретный геномный локус, сначала коэкспрессировали dCas9 и sgRNA_dual-MTS для нацеливания на локус в клетках. За этим следует доставка как донорных, так и акцепторных MB (MB с двойным FRET), что после гибридизации с одним и тем же двойным MTS может привести к тому, что FRET будет освещать целевой локус.

    Рисунок 1.

    Схема CRISPR / dual-FRET MB для маркировки определенного локуса. Чтобы осветить конкретный геномный локус, сначала коэкспрессировали dCas9 и sgRNA_dual-MTS для нацеливания на локус в клетках.За этим следует доставка как донорных, так и акцепторных MB (MB с двойным FRET), что после гибридизации с одним и тем же двойным MTS может привести к тому, что FRET будет освещать целевой локус.

    МАТЕРИАЛЫ И МЕТОДЫ

    Клонирование экспрессионных конструкций dCas9

    Для создания BFP / dCas9-C1, который кодирует BFP (контроль трансфекции) и дезактивированный нуклеазой Streptococcus pyogenes Cas9 (dCas9) под контролем отдельных промоторов, sgRNA, нацеленная на теломеры (sgTelo), была удалена из sgTelo / BFP. / dCas9-C1, описанный ранее (9) с использованием AseI, с последующим самолигированием полученного вектора.Для создания pCMV-dCas9-EGFP-C1, который кодирует dCas9, слитый с EGFP (dCas9-EGFP), кодирующая область dCas9-EGFP была сначала амплифицирована с помощью ПЦР из pSLQ1658-dCas9-EGFP (плазмида Addgene № 51023) (4) с использованием прямого праймер 5′-GCTACCGGTCGCCACCATGGTGCCCAAAAAGAAGAGGAAAGTGGACAAGA-3 ‘и обратный праймер 5′-GTAGAATTCTTACTTGTACAGCTCGTCCATGCCGAG-3’. Затем продукт ПЦР вставляли в вектор pmTagBFP2-C1 (подарок от Prabuddha Sengupta, Janelia Research Campus, США), расщепленный AgeI и EcoRI, чтобы вырезать mTagBFP2.

    Клонирование конструкций экспрессии sgRNA

    Для маркировки неповторяющихся областей

    Плазмида, несущая кассету U6-sgRNA_dual-MTS, была изготовлена ​​на заказ Пекинским институтом геномики (Пекин, Китай) и использовалась для создания плазмиды остова для каждой sgRNA, нацеленной на неповторяющуюся область. В частности, спейсерная последовательность sgRNA_dual-MTS была заменена спейсерной последовательностью, разработанной для гибридизации с уникальной областью в локусе MUC4, MUC1 или IGR или бессмысленной спейсерной последовательностью (контроль) посредством ПЦР-опосредованной сайт-направленной мутагенез (см. дополнительную таблицу S1 для информации о каркасах sgRNA, дополнительную таблицу S2 для информации о спейсерах / целевой области и дополнительную таблицу S3 для информации о праймерах).После этого продукт ПЦР кассеты U6-sgRNA_dual-MTS из каждой плазмиды остова (Прямой праймер: 5′-ACTGCTGTCGACAATGCGTCGAGATCCAATTAGTTAT-3 ‘; обратный праймер: 5’-ACCTGCGATGATCCCTCGAGTGATAGACTGACCTCGAGTGATAGACACCTCGAGTGATAGACAz + вектор, расщепленный с помощью SalI и BamHI, для создания конструкции экспрессии sgRNA для каждой sgRNA. Из полученных конструкций был создан набор мультиплексированных экспрессионных конструкций sgRNA, содержащих различное количество уникальных кассет U6-sgRNA_dual-MTS (см. Дополнительную таблицу S4) с использованием протокола, описанного ранее van den Bogaard и Tyagi (17).Для MUC4 была также создана конструкция для мультиплексной экспрессии sgRNA, кодирующая три уникальных sgRNA без двойной MTS (sgMUC4) с теми же спейсерами, что и 3 sgMUC4_dual-MTS из набора I (см. Дополнительную таблицу S1, таблицу S2 и таблицу S4). с использованием того же протокола с родительскими конструкциями, полученными с помощью ПЦР-опосредованного сайт-направленного мутагенеза для удаления двойной-MTS и дополнительных последовательностей, фланкирующих двойную-MTS, с использованием прямого праймера 5′-GAAAAAGTGGCACCGAGTCGGTGCTTT-3 ‘и обратного праймера 5’-AAGTTGATAACGGACTAGCCTT- 3 ′.

    Для маркировки повторяющихся областей

    Для создания pSLQ1661-sgMUC4-E3 (F + E) / BFP, конструкции, которая кодирует немодифицированную sgRNA (без двойной MTS) со спейсерной последовательностью, комплементарной повторяющейся последовательности, проксимальной к неповторяющимся областям MUC4 ген ( MUC4, -NRR), как описано выше (sgRNA-rep (Proximal to MUC4 -NRR), см. дополнительную таблицу S1 и таблицу S5), mTagBFP2 амплифицировали с помощью ПЦР из вектора pmTagBFP2-C1 с использованием прямого праймера 5′- AGCGCTACCGGTCGCCACCATG-3 ‘и обратный праймер 5′-ACTGCAGAATTCTTAATTAAGCTTGTGCCCCAGTTTGC-3’, а затем вставленный в pSLQ1661-sgMUC4-E3 (F + E) (плазмида Addgene № 51025) (4) расщеплена с помощью EcoRI, чтобы удалить с помощью AgeI эксцизию mCherry (4) и расщепить mCherry с помощью AgeI.Для создания конструкций, которые кодируют sgRNAs, нацеленные на другие повторяющиеся области (см. Дополнительную таблицу S5), кассету U6-sgMUC4-E3 (F + E) pSLQ1661-sgMUC4-E3 (F + E) / BFP сначала амплифицировали с использованием прямого праймера 5. ‘-ACTGCTGTCGACTTTGGTTAGTACCGGGCCCGCTCTA-3′ и обратный праймер 5’-CTAATGGATCCTAGTACTCGAGAAA-3 ‘с последующим субклонированием продукта ПЦР в вектор pGEM-11zf (+), расщепленный SalI и BamHI. Последовательность спейсера в векторе субклонирования заменяли спейсером каждой sgRNA посредством PCR-опосредованного сайт-направленного мутагенеза (информацию о праймерах см. В дополнительной таблице S6).Область, которая содержит кассету U6-sgRNA в полученной плазмиде, затем была клонирована обратно в pSLQ1661-sgMUC4-E3 (F + E) / BFP, расщепленная XbaI и BamHI, чтобы вырезать кассету U6-sgMUC4-E3 (F + E). .

    Синтез МБ

    Донорский МБ был помечен гасителем Iowa Black FQ на 5′-конце и флуорофором ATTO550 на 3′-конце и имел последовательность: 5′-mCmUmCmAmG * mC * mG * mU * mA * mA * mG * mU * mG * mA * mU * mG * mU * mC * mG * mU * mG * mA * mCmUmGmAmG-3 ′. Акцепторный MB был помечен флуорофором ATTO647N на 5′-конце и гасителем Iowa Black RQ на 3′-конце и имел последовательность: 5′-mCmUmUmCmG * mU * mC * mC * mA * mC * mA * mA * mA * mC * mA * mC * mA * mA * mC * mU * mC * mC * mU * mGmAmAmG-3 ‘(подчеркнутые буквы обозначают стержень MB, m представляет модификацию 2’- O -метил РНК; * представляет собой модификацию фосфоротиоатной связи).Последовательности MB предназначены для предотвращения гибридизации с эндогенными РНК в клетках млекопитающих. Все МБ были синтезированы компанией Integrated DNA Technologies (Coralville, IA, USA).

    Культура клеток и трансфекция

    клеток HeLa и U2OS (Американская коллекция типовых культур) культивировали в среде Игла, модифицированной Дульбекко (DMEM, Mediatech), с добавлением 10% (об. / Об.) FBS (PAN ™ Biotech) и 1 × GlutaMAX ™ (Thermo Fisher) при 37 ° C. ° C, 5% (об. / Об.) CO 2 и относительная влажность 90%.Трансфекцию плазмиды проводили FuGENE ® 6 (Promega) в соответствии с протоколами производителя, когда клетки достигли 50-70% конфлюэнтности в 6-луночном планшете. Для визуализации неповторяющихся областей с использованием CRISPR / dual-FRET MB клетки HeLa или U2OS трансфицировали 600 нг BFP / dCas9-C1 и 1400 нг либо одиночной, либо мультиплексной конструкции экспрессии sgRNA (см. Дополнительную таблицу S4). Для экспериментов по совместному мечению клетки трансфицировали 600 нг pCMV-dCas9-EGFP-C1, 600 нг мультиплексированной конструкции экспрессии sgRNA и 600 нг pSLQ1661-sgRNA-rep.Для экспериментов по гибридизации с флуоресценцией in situ клетки HeLa, засеянные на 8-луночное покровное стекло с камерами Lab-Tek ™, предварительно покрытое фибронектином, трансфицировали 60 нг BFP / dCas9-C1, 60 нг pSLQ1661-sgRNA-rep (дистальнее MUC4 -NRR) и 60 нг pSLQ1661-sgRNA-rep (проксимально к MUC4 -NRR). Все эксперименты проводились с клетками при количестве пассажей от 5 до 25.

    Доставка МБ

    МБ были доставлены в клетки путем нуклеофекции / микропорации в соответствии с методами, описанными ранее (18–20), с модификациями.Вкратце, клетки, выросшие до 70% конфлюэнтности, трипсинизировали, промывали 1 × PBS и осаждали с последующим ресуспендированием в 11 мкл 1 × PBS, содержащего равные количества донорных и акцепторных МБ, для получения конечной концентрации клеток 5000 клеток на мкл и конечная концентрация МБ 2 мкМ для каждого МБ. После этого 10 мкл смеси клеток (примерно 50000 клеток) были подвергнуты нуклеофекции с использованием системы трансфекции Neon ® с параметрами, установленными на 1005 В с длительностью импульса 35 мс и двумя импульсами всего для клеток HeLa и 1230 В с периодом 10 мс. ширина импульса и всего четыре импульса для ячеек U2OS.После нуклеофекции и трех промывок в культуральной среде для удаления свободных МБ клетки высевали на 8-луночное покровное стекло с камерами Lab-Tek TM , предварительно покрытое фибронектином.

    Следует отметить, что другие методы клеточной доставки, такие как стрептолизин-O (15), также использовались для доставки МБ, и поэтому ожидается, что они будут эффективными для доставки донорных и акцепторных МБ, используемых в этом исследовании.

    Флуоресценция

    in situ гибридизация

    клеток HeLa, содержащих dCas9, sgRNA-rep (Distal to MUC4 -NRR) и sgRNA-rep (Proximal to MUC4 -NRR) (см. Дополнительную таблицу S5), подвергали флуоресцентным экспериментам in situ гибридизации (FISH). как описано ранее (3,9), с изменениями.Вкратце, клетки фиксировали 4% параформальдегидом (PFA) в 1 × PBS в течение 30 мин при комнатной температуре с последующими двумя промываниями 1 × PBS. После этого клетки подвергали проницаемости 0,5% (об. / Об.) NP-40 в 1 × PBS в течение 10 мин, а затем промывали один раз 1 × PBS. После 5-минутной инкубации клеток в 1 × PBS клетки инкубировали в буфере для гибридизации (1% (об. / Об.) Tween ® 20, 10% (об. / Об.) Сульфат декстрана, 50% (об. / Об.) об.) формамида, 500 нг / мл ДНК спермы лосося в буфере 2 × солевой раствор цитрата натрия (SSC)), содержащем 100 нМ зондов FISH (5′-CCGTCAATTTACTTTATGTCT-ATTO488-3 ‘) и 100 нМ зондов FISH (5’-TAMRA- CCTCCTGTCACCGAC-3 ‘), нацеленный на повторяющиеся области, дистальнее MUC4, -NRR и проксимальнее MUC4, -NRR, соответственно, в увлажненной камере при 37 ° C в течение 24 часов.Клетки промывали промывочным буфером (2 × SSC, 10% (об. / Об.) Формамид), затем 2 × SSC, 1 × SSC и 0,2 × SSC для удаления негибридизированных зондов, а затем инкубировали в 1 × PBS перед визуализацией. Следует отметить, что взаимодействия между dCas9 и sgRNA приводят к раскручиванию дуплекса ДНК, позволяя зондам FISH гибридизоваться с цепью, не связанной со спейсером sgRNA, без необходимости высокотемпературного нагревания.

    Флуоресцентная микроскопия

    Эксперименты по флуоресцентной микроскопии

    проводили на моторизованном инвертированном флуоресцентном микроскопе Olympus IX 83, оборудованном системой CellTIRF-4Line, 100 × UPlanSApo 1.Объектив 4NA, камера EMCCD с задней подсветкой (Andor), колеса с фильтром возбуждения и эмиссии Саттера под управлением программного обеспечения CellSens Dimension. Изображения DAPI, EGFP / ATTO488 и TAMRA были получены с использованием набора фильтров Olympus MT20 для DAPI, EGFP и TAMRA, а изображения FRET и ATTO647N были получены с использованием наборов фильтров Chroma (ET545 / 25x, ET700 / 75m, T565lpxr) и (ET620 / 60x, ET700 / 75m, T660lpxr), соответственно, с возбуждающим светом, обеспечиваемым источником света X-Cite Series 120 с ртутной лампой (EXFO).Одновременные двухцветные изображения EGFP и FRET были получены с использованием IX3-U-m4TIR-Sbx и DV2-cube (ET525 / 50m, 585dcxr, ET655lp, Photometrics) с возбуждающим светом EGFP и FRET, обеспечиваемым 488 нм лазерная линия (150 мВт) и лазерная линия 561 нм (150 мВт) соответственно. Пакеты трехмерных (3D) изображений были получены с шагом 0,25 мкм в направлении z. Все изображения были проанализированы с использованием Fiji (21), программы деконволюции AutoQuant (MediaCybernetics) или специально написанных программ MATLAB (версия R2014b, 64-разрядная, Mathworks).

    Идентификация одиночных геномных локусов

    Идентификация отдельных геномных локусов в клетках HeLa и U2OS была выполнена, как описано ранее (18,19), с небольшими модификациями. Короче говоря, вычитание фона катящимся шариком (background = 2) было сначала применено ко всем 3D-изображениям для улучшения твердых частиц. После этого была проведена идентификация частиц с использованием плагина 3D Laplacian of Gaussian, доступного для Фиджи. После ручной установки порога для удаления пятен низкой интенсивности вокруг каждого ядра была нарисована область интереса (ROI) и применена к отфильтрованному стеку.Подключаемый модуль макроса Find Stack Maxima (Exclude Edge Maxima; Noise Tolerance = 0) затем использовался для определения всех локальных максимумов в каждом срезе z-стека. Чтобы определить, какие двумерные (2D) локальные максимумы были трехмерными локальными максимумами, и количественно оценить общее количество трехмерных локальных максимумов, была написана специальная программа MATLAB для сравнения интенсивности каждого локального максимума в каждом срезе с интенсивностью каждого пикселя в пределах воксельный куб 5 × 5 × 5 с центром вокруг локального максимума. Каждый трехмерный максимум считался отдельным локусом и вычислялось общее количество локусов на ядро.

    Трехмерный анализ колокализации

    После определения трехмерных координат геномных локусов в изображениях dCas9-EGFP и двойных FRET MB с использованием методов, описанных выше, была использована специальная программа MATLAB для определения уровня колокализации в трехмерном пространстве, как описано ранее (18,19), с незначительными модификации. Вкратце, трехмерный локальный максимум МБ считался событием колокализации МБ, если трехмерный локальный максимум EGFP был обнаружен в воксельном кубе 7 × 7 × 7 с центром вокруг максимума МБ.Процент совместной локализации рассчитывали путем деления количества событий совместной локализации МБ на общее количество локальных максимумов МБ.

    Анализ отношения сигнал / шум

    2D-изображения были получены как для MB с двойным FRET, так и для одиночных MB с выдержкой в ​​одну секунду и подверглись анализу отношения сигнал / шум (SNR), как описано ранее (22), по следующей формуле:

    $$ \ begin {уравнение *} {\ rm {SNR}} = \ frac {{{{\ rm {i}} _ {{\ rm {spot \ signal, \ maximum}}}} — {{\ rm {i}} _ {{\ rm {background, \ mean}}}}}} {{{{\ rm {i}} _ {{\ rm {background, \ \ sigma}}}}}}} \ end {формула *} $$

    , где i точечный сигнал, максимум относится к максимальной интенсивности флуоресценции одного локуса генома, i фон, среднее относится к среднему фоновому сигналу и i фон, σ относится к стандарту отклонение фонового сигнала.

    Анализ отслеживания отдельных частиц

    двухмерных покадровых изображения были проанализированы для идентификации треков отдельных геномных локусов с использованием плагина TrackMate от Fiji, как описано ранее (18,19). Вкратце, отдельные пики и их координаты определялись с помощью детектора лапласиана Гаусса (LoG). После этого пики, принадлежащие одному и тому же треку, определялись простым трекером проблем с линейным назначением (LAP). Полученные треки затем были использованы для анализа совместного движения и коэффициента диффузии, как описано ниже:

    Анализ совместного движения .Для анализа совместного движения пятна с меткой dCas9-EGFP и пятна с меткой CRISPR / dual-FRET MB использовались одновременные двухцветные изображения, полученные со скоростью 10 кадров в секунду (fps). В наборе двухцветных изображений пятна в канале EGFP и в канале FRET были спарены на основе ближайшего пространственного расстояния. После назначения пар точек были определены координаты x y каждой точки с параметрами LAP, установленными на максимальное расстояние связывания = 0,5 мкм; максимальное расстояние закрытия зазора = 0; Максимальный разрыв кадра закрытия промежутка = 0, за которым следует анализ взаимной корреляции пар пятен в MATLAB на основе следующей формулы, как описано ранее (23):

    $$ \ begin {уравнение *} {\ rm {\ rho \}} = \ frac {{\ left \ langle {{{\ boldsymbol {r}} _ {EGFP}} \ cdot {{\ boldsymbol {r}} _ {FRET}}} \ right \ rangle — \ left \ langle {{ {\ boldsymbol {r}} _ {EGFP}}} \ right \ rangle \ cdot \ left \ langle {{{\ boldsymbol {r}} _ {FRET}}} \ right \ rangle}} {{{{\ left [{\ left ({\ left \ langle {{\ boldsymbol {r}} _ {EGFP} ^ 2} \ right \ rangle — {{\ left \ langle {{{\ boldsymbol {r}} _ {EGFP}}) } \ right \ rangle} ^ 2}} \ right) \ left ({\ left \ langle {{\ boldsymbol {r}} _ {FRET} ^ 2} \ right \ rangle — {{\ left \ langle {{{ \ boldsymbol {r}} _ {FRET}}} \ right \ rangle} ^ 2}} \ right)} \ right]} ^ {1/2}}}} {\ rm {\}} \ end {уравнение * } $$

    , где ρ — коэффициент взаимной корреляции, r EGFP и r FRET — векторы положения пятен с метками dCas9-EGFP и CRISPR / dual-FRET MB. , соответственно.ρ изменяется от -1 для полностью антикоррелированных движений до +1 для полностью коррелированных движений. Анализ коэффициента диффузии . Для анализа коэффициентов диффузии использовались изображения, полученные со скоростью 50 кадров в секунду, с параметрами LAP, установленными на максимальное расстояние связывания = 0,1 мкм; максимальное расстояние закрытия зазора = 0,4 мкм; Максимальный интервал кадра закрытия промежутка = 4. Результирующие пики и их координаты x y были импортированы в @msdanalyzer, записанный в MATLAB (24), и дорожки, содержащие не менее 15 временных лагов (Δτ), были выбраны для вычисления среднего Квадратное смещение (MSD).\ alpha} \ end {формула *} $$

    с использованием первых 25% общего времени запаздывания с минимальным порогом соответствия R 2 > 0,8. Дорожки с α 1,2 представляли собой направленный транспорт.

    Анализ данных

    Статистический анализ проводился с использованием либо двустороннего критерия Стьюдента t , либо одностороннего дисперсионного анализа с апостериорным тестированием парных сравнений с использованием критерия Шеффе.

    РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

    Оценка чувствительности CRISPR / dual-FRET MB для визуализации неповторяющихся областей генома

    Мы сконструировали плазмиды, экспрессирующие sgRNA, которые кодируют 1, 2, 3 или 6 уникальных sgRNA_dual-MTS для мечения неповторяющихся областей гена MUC4 (sgMUC4_dual-MTS) с последовательностями спейсеров, нацеленных на ДНК, выбранными из пула 73 MUC4 -нацеливающие sgRNA (4), ранее использовавшиеся для визуализации CRISPR на основе FP (дополнительные таблицы S1 – S4).После котрансфекции модифицированных sgRNAs вместе с dCas9 и BFP (в качестве контроля трансфекции) в клетках HeLa ядерная доставка MB донора FRET, меченного ATTO550, и MB акцептора FRET, меченного ATTO647N, была достигнута посредством нуклеофекции. В качестве контроля клетки также трансфицировали sgRNA_dual-MTS, несущую бессмысленную спейсерную последовательность (sgControl_dual-MTS), и подвергали нуклеофекции с помощью MB. Была выдвинута гипотеза, что если двойная MTS не мешает sgRNA-управляемому связыванию dCas9 с целевым локусом, гибридизация как донорных, так и акцепторных MB с двойным MTS, приводящая к FRET, должна осветить локус MUC4 как яркое пятно. при просмотре с помощью широкопольной флуоресцентной микроскопии.Было обнаружено, что через 24 часа после доставки MB яркие пятна в диапазоне от 1 до 6 копий могут быть обнаружены в 41% и 39% клеток с 6 и 3 sgMUC4_dual-MTS, соответственно (Рисунок 2). Среднее (± S.E.) количество пятен составляло 2,54 ± 0,13 и 2,45 ± 0,11 в клетках с шестью и тремя sgRNA соответственно, что согласуется с ранее сообщенными значениями для локуса MUC4 в клетках HeLa (4,25). Напротив, очень мало пятен было обнаружено в клетках, трансфицированных двумя или одной sgRNA, аналогично результатам, полученным с sgControl_dual-MTS.Поскольку яркие пятна присутствовали в клетках с sgMUC4_dual-MTS, но в очень низкой степени в клетках с контрольной sgRNA, похоже, что наблюдаемые пятна возникают из-за гибридизации MB с комплексами dCas9-sgRNA, связанными с локусом MUC4 , скорее, чем к свободным sgRNA или комплексам dCas9-sgRNA. Подтверждая это, аналогичные эксперименты, проведенные на клетках U2OS, также показали, что CRISPR / dual-FRET MB может освещать неповторяющиеся области MUC4 тремя уникальными sgMUC4_dual-MTS, но не sgControl_dual-MTS (дополнительные рисунки S1A и B).Кроме того, сигналы MB с двойным FRET были очень близки к клеточному фону в клетках с тремя немодифицированными sgRNA (без двойной MTS), нацеленными на одни и те же неповторяющиеся области MUC4 (sgMUC4) (дополнительный рисунок S2), подтверждая, что наблюдаемые пятна в ячейках с тремя уникальными sgMUC4_dual-MTS в результате специфической гибридизации MB с двойным MTS. Доказательства того, что CRISPR / dual-FRET MB действительно может маркировать неповторяющиеся области MUC4 тремя уникальными sgRNA, получены в экспериментах по совместному мечению с использованием dCas9, слитого с EGFP (dCas9-EGFP), и немодифицированной sgRNA (без двойной MTS) нацеливания. повторяющиеся области достаточного размера, необходимые для обнаружения (4), на одной и той же хромосоме (рис. 3A и B).В частности, локализация и движение сигналов MB CRISPR / dual-FRET в высокой степени соответствовали сигналам dCas9-EGFP, когда немодифицированная sgRNA рекрутировала несколько dCas9-EGFP в повторяющиеся области в локусе MUC4 , но не тогда, когда dCas9- EGFP был нацелен на более отдаленные повторяющиеся области (рис. 3C – E, дополнительные рисунки S1C – F, S3 и дополнительные фильмы S1 – S4). Кроме того, CRISPR / dual-FRET MB может также освещать неповторяющиеся области гена MUC1 и межгенную область ДНК (IGR) при использовании трех уникальных нацеленных на MUC1 sgRNA_dual-MTS (sgMUC1_dual-MTS) или нацеливания на IGR. sgRNA_dual-MTS (sgIGR_dual-MTS) соответственно (дополнительные рисунки S4, S5 и дополнительные фильмы S5-S8).Примечательно, что эффективность обнаружения сильно зависела от выбора sgRNA, поскольку второй набор sgRNA дал гораздо более низкую эффективность обнаружения, чем первичный набор (Set I) для каждого локуса (дополнительный рисунок S6), предположительно потому, что не все геномные области одинаково доступны для Комплексы dCas9-sgRNA из-за различий в топологической сложности или наличия ДНК-связывающих белков. Таким образом, необходимо проводить скрининг sgRNA, эффективность обнаружения которых намного превышает фоновый уровень (т. Е.2,3% клеток с неспецифическими пятнами при экспрессии sgControl_dual-MTS, см. Рисунок 2B). Наконец, было достигнуто более низкое отношение сигнал / шум и было обнаружено меньшее количество геномных локусов, когда отдельные МБ были использованы для изображения локусов MUC4 по сравнению с МБ с двойным FRET (дополнительный рисунок S7), что позволяет предположить, что в контексте геномной визуализации подход с двойным FRET MB более чувствителен, чем подход с одним MB, как было замечено в предыдущих исследованиях, когда эти два подхода сравнивались в контексте визуализации РНК (15,16).В совокупности эти результаты показывают, что CRISPR / dual-FRET MB при использовании в сочетании с широкопольной флуоресцентной микроскопией может освещать неповторяющиеся области генома всего с тремя уникальными sgRNA.

    Рисунок 2.

    Отображение неповторяющихся областей MUC4 с помощью CRISPR / dual-FRET MB с различным количеством уникальных sgRNA, нацеленных на MUC4 . Клетки HeLa, экспрессирующие dCas9 и 6, 3, 2 или 1 уникальный sgMUC4_dual-MTS или sgControl_dual-MTS, подвергали нуклеофекции с помощью MB с двойным FRET.Изображения флуоресцентной микроскопии получали через 24 часа после нуклеофекции. ( A ) Репрезентативные проекционные изображения максимальной интенсивности сигналов MB с двойной FRET в фиксированных ячейках. Шкала 10 мкм. ( B ) Распределение номеров точек по ячейкам. На вставке показана эффективность обнаружения. n = 300 клеток из трех независимых экспериментов для каждого условия.

    Рисунок 2.

    Отображение неповторяющихся областей MUC4 с помощью CRISPR / dual-FRET MB с различным количеством уникальных sgRNA, нацеленных на MUC4 .Клетки HeLa, экспрессирующие dCas9 и 6, 3, 2 или 1 уникальный sgMUC4_dual-MTS или sgControl_dual-MTS, подвергали нуклеофекции с помощью MB с двойным FRET. Изображения флуоресцентной микроскопии получали через 24 часа после нуклеофекции. ( A ) Репрезентативные проекционные изображения максимальной интенсивности сигналов MB с двойной FRET в фиксированных ячейках. Шкала 10 мкм. ( B ) Распределение номеров точек по ячейкам. На вставке показана эффективность обнаружения. n = 300 клеток из трех независимых экспериментов для каждого условия.

    Рисунок 3.

    CRISPR / dual-FRET MB может освещать неповторяющиеся области MUC4 с 3 уникальными sgRNA. Клетки HeLa, экспрессирующие dCas9-EGFP, три уникальных sgMUC4_dual-MTS (набор I, см. Дополнительную таблицу S4) и немодифицированную sgRNA, нацеленную на высокоповторяющиеся области генома (sgRNA-rep) на одной и той же хромосоме (Chr3), подвергали нуклеофекции с помощью двойного FRET. МБ. ( A ) Схема эксперимента по совместной маркировке. ( B ) Схема, показывающая положение неповторяющихся областей (NRR) и повторяющихся областей (RR) проксимальнее или дистальнее NRR на Chr3, выбранном для мечения.( C ) Типичные проекционные изображения максимальной интенсивности сигналов MB с двойным FRET и dCas9-EGFP в фиксированных клетках. На вставке показана совместная локализация двух сигналов, когда dCas9-EGFP метит проксимальный RR через sgRNA-rep. Шкала 10 мкм. ( D ) Процент сигналов MB двойного FRET, колокализующихся с сигналами dCas9-EGFP (% MB двойного FRET колокализации), представляющих проксимальный или дистальный RR на клеточной основе (n = 35 клеток для проксимального RR и 30 клеток). клетки для дистального RR). ( E ) Коэффициент корреляции между сигналами двойного FRET MB и dCas9-EGFP (коэффициент совместного движения) в живых клетках.15 траекторий каждого сигнала были проанализированы для проксимального RR и 18 траекторий каждого сигнала были проанализированы для дистального RR, оба из 12 клеток. Обратите внимание, что коэффициент совместного движения, равный 1, указывает на идеальное совместное движение. Все данные представляют собой среднее значение ± стандартное отклонение. трех независимых экспериментов. Звездочки указывают значения P (*** P <0,001).

    Рисунок 3.

    CRISPR / dual-FRET MB может освещать неповторяющиеся области MUC4 с 3 уникальными sgRNA. Клетки HeLa, экспрессирующие dCas9-EGFP, три уникальных sgMUC4_dual-MTS (набор I, см. Дополнительную таблицу S4) и немодифицированную sgRNA, нацеленную на высокоповторяющиеся области генома (sgRNA-rep) на одной и той же хромосоме (Chr3), подвергали нуклеофекции с помощью двойного FRET. МБ.( A ) Схема эксперимента по совместной маркировке. ( B ) Схема, показывающая положение неповторяющихся областей (NRR) и повторяющихся областей (RR) проксимальнее или дистальнее NRR на Chr3, выбранном для мечения. ( C ) Типичные проекционные изображения максимальной интенсивности сигналов MB с двойным FRET и dCas9-EGFP в фиксированных клетках. На вставке показана совместная локализация двух сигналов, когда dCas9-EGFP метит проксимальный RR через sgRNA-rep. Шкала 10 мкм. ( D ) Процент сигналов MB двойного FRET, колокализующихся с сигналами dCas9-EGFP (% MB двойного FRET колокализации), представляющих проксимальный или дистальный RR на клеточной основе (n = 35 клеток для проксимального RR и 30 клеток). клетки для дистального RR).( E ) Коэффициент корреляции между сигналами двойного FRET MB и dCas9-EGFP (коэффициент совместного движения) в живых клетках. 15 траекторий каждого сигнала были проанализированы для проксимального RR и 18 траекторий каждого сигнала были проанализированы для дистального RR, оба из 12 клеток. Обратите внимание, что коэффициент совместного движения, равный 1, указывает на идеальное совместное движение. Все данные представляют собой среднее значение ± стандартное отклонение. трех независимых экспериментов. Звездочки указывают значения P (*** P <0,001).

    Изучение динамики неповторяющихся геномных локусов с использованием CRISPR / dual-FRET MB

    Хроматин очень динамичен и подвержен ремоделированию (26).Следовательно, методика, способная фиксировать движение определенного геномного локуса с высоким пространственно-временным разрешением, должна способствовать углубленной характеристике архитектур генома в реальном времени. Успешно продемонстрировав способность CRISPR / dual-FRET MB для освещения неповторяющихся локусов с помощью трех уникальных sgRNA, мы затем оценили возможности этой стратегии для визуализации динамики хроматина. Чтобы проверить это, мы осветили неповторяющиеся области MUC4, MUC1 и IGR в клетках HeLa, используя CRISPR / dual-FRET MB с тремя sgMUC4_dual-MTS, sgMUC1_dual-MTS и sgIGR_dual-MTS (набор I, см. Дополнительный рисунок. S6) соответственно.Интересно, что анализ отслеживания одиночных частиц показал, что, хотя все обнаруженные локусы демонстрируют диффузное поведение (α <1,2), три разных локуса демонстрируют уникальные диапазоны движения, а также коэффициенты диффузии (рисунок 4 и дополнительные фильмы S9 – S11), предположительно отражая их различия в транскрипционной активности и местной среде (27). Мы должны подчеркнуть, что три sgRNAs, используемые для визуализации, предназначенные для нацеливания на ∼770 п.н. в MUC4, , ∼300 п.н. в MUC1, и ∼220 п.н. в IGR, были выбраны на основе доступности смежного мотива протоспейсера (PAM) и спейсера. специфичность.Наш CRISPR / dual-FRET MB также должен позволять визуализировать другие неповторяющиеся области аналогичного или меньшего размера, предлагая возможность для мониторинга архитектуры генома с высокой четкостью и живыми клетками.

    Рисунок 4.

    Динамика одиночных локусов MUC4, MUC1, и IGR, выявленных MB CRISPR / dual-FRET с тремя уникальными sgRNA_dual-MTS. Клетки HeLa, экспрессирующие dCas9 и три уникальных sgMUC4_dual-MTS, sgMUC1_dual-MTS или sgIGR_dual-MTS (набор I), подвергали нуклеофекции с помощью MB с двойным FRET.Изображения флуоресцентной микроскопии получали через 24 часа после нуклеофекции. ( A ) Репрезентативные траектории отдельных локусов, полученные в течение временного окна 0,5 с. Пунктирные кружки указывают диапазон движения. ( B ) Диаграммы разброса коэффициентов диффузии (D eff ) отдельных локусов. Суммарные траектории MUC4, (89 траекторий), MUC1, (80 траекторий) и IGR (88 траекторий) были проанализированы из 81, 68 и 75 ячеек соответственно. Все данные представляют собой среднее значение ± S.Э. трех независимых экспериментов. Звездочки указывают значения P (** P <0,01, *** P <0,001).

    Рисунок 4.

    Динамика одиночных локусов MUC4, MUC1, и IGR, выявленных MB CRISPR / dual-FRET с тремя уникальными sgRNA_dual-MTS. Клетки HeLa, экспрессирующие dCas9 и три уникальных sgMUC4_dual-MTS, sgMUC1_dual-MTS или sgIGR_dual-MTS (набор I), подвергали нуклеофекции с помощью MB с двойным FRET. Изображения флуоресцентной микроскопии получали через 24 часа после нуклеофекции.( A ) Репрезентативные траектории отдельных локусов, полученные в течение временного окна 0,5 с. Пунктирные кружки указывают диапазон движения. ( B ) Диаграммы разброса коэффициентов диффузии (D eff ) отдельных локусов. Суммарные траектории MUC4, (89 траекторий), MUC1, (80 траекторий) и IGR (88 траекторий) были проанализированы из 81, 68 и 75 ячеек соответственно. Все данные представляют собой среднее значение ± стандартное отклонение. трех независимых экспериментов. Звездочки указывают значения P (** P <0.01, *** P <0,001).

    Заключение

    Таким образом, мы объединили CRISPR и MB с двойным FRET для разработки системы CRISPR / dual-FRET MB, которую можно использовать для измерения динамики неповторяющихся участков отдельных геномных локусов в геноме человека всего с тремя уникальными sgRNA. Следует отметить, что в то время как неповторяющиеся области генома ранее визуализировались с помощью основанных на FP подходов к визуализации CRISPR с помощью дифракционно-ограниченной флуоресцентной микроскопии (4,6-8), с одной чувствительной системой, которая использует 4 уникальных sgRNAs, нацеленных на ~ 3800 п.н. MUC4 сообщает о наличии 2.В среднем 2 пятна на клетку (6), каждая sgRNA была экстенсивно модифицирована, чтобы содержать 16 аптамеров MS2 для мечения 32 копий белка оболочки MS2, слитого с FP (MCP-FP), что вызывает опасения относительно того, проявляют ли меченые локусы нормальную физиологическую активность. . Кроме того, необходимость добавления нескольких копий аптамера в тандеме может усложнить клонирование, поскольку плазмиды, кодирующие несколько тандемных повторов, подвержены рекомбинации. Кроме того, комплексы dCas9-sgRNA, помеченные множеством FP, могут быть очень чувствительны к агрегации, что приводит к образованию неспецифических точек высокой интенсивности, которые могут быть ошибочно интерпретированы как геномные локусы (10).Учитывая, что общая масса одного комплекса визуализации CRISPR / dual-FRET MB (∼242 кДа) составляет примерно 14% от общей массы одного комплекса визуализации системы на основе MS2, несущей 32 MCP-FP (∼1,76 МДа) (Дополнительная таблица S7) и обе системы демонстрируют схожую эффективность обнаружения для MUC4 неповторяющихся областей, мы пришли к выводу, что CRISPR / dual-FRET MB является высокочувствительной платформой для визуализации живых клеток неповторяющихся геномных локусов со способностью обеспечивают наиболее точное отображение нормальной динамики хроматина на сегодняшний день.

    Мы также должны подчеркнуть, что, хотя технология CRISPR / dual-FRET MB демонстрирует гораздо большую чувствительность для обнаружения геномных локусов, чем ее родительский подход, который использует один MB, она может быть менее применима в исследованиях, где необходимо визуализировать несколько геномных локусов одновременно, поскольку новая технология предполагает наличие двух оптически разных MB для вызова сигнала FRET. Мы предполагаем использование более продвинутых оптических методов, таких как визуализация сверхвысокого разрешения (28) и мультиспектральная визуализация (29), а включение более совершенных пар флуорофор / гаситель может расширить универсальность CRISPR / dual-FRET MB, что позволит проводить исследования организации генома как на коротких, так и на больших расстояниях и их физиологические роли в широком диапазоне пространственных и временных масштабов.

    ДОПОЛНИТЕЛЬНЫЕ ДАННЫЕ

    Дополнительные данные доступны в NAR Online.

    ФИНАНСИРОВАНИЕ

    Национальная программа ключевых исследований и разработок Китая [2016YFA0100702 и 2016YFA0501603]; Национальный фонд естественных наук Китая [31771583]. Финансирование платы за открытый доступ: Национальная программа ключевых исследований и разработок Китая [2016YFA0100702].

    Заявление о конфликте интересов . Ничего не объявлено.

    ССЫЛКИ

    1.

    Knight

    S.

    ,

    Tjian

    R.

    ,

    Doudna

    J.

    Геномы в центре внимания: разработка и применение технологий визуализации Crispr-Cas9

    .

    Angew. Chem. Int. Эд. Англ.

    2017

    ;

    57

    :

    4329

    4337

    .2.

    Wu

    X.

    ,

    Mao

    S.

    ,

    Ying

    Y.

    ,

    Krueger

    C.J.

    ,

    Чен

    А.К.

    Прогресс и проблемы в области визуализации геномных локусов живых клеток с использованием платформ на основе CRISPR

    .

    Геномика Протеомика Биоинформатика

    .

    2019

    ;

    17

    :

    119

    128

    .3.

    Chen

    B.

    ,

    Guan

    J.

    ,

    Huang

    B.

    Визуализация специфической геномной ДНК в живых клетках

    .

    Annu. Rev. Biophys.

    2016

    ;

    45

    :

    1

    23

    .4.

    Chen

    B.H.

    ,

    Gilbert

    L.A.

    ,

    Cimini

    B.A.

    ,

    Schnitzbauer

    J.

    ,

    Zhang

    W.

    ,

    Li

    G.W.

    ,

    Park

    J.

    ,

    Blackburn

    E.H.

    ,

    Weissman

    J.S.

    ,

    Ци

    Л.С.

    et al. .

    Динамическое отображение локусов генома в живых клетках человека с помощью оптимизированной системы CRISPR / Cas

    .

    Ячейка

    .

    2013

    ;

    155

    :

    1479

    1491

    . 5.

    Ma

    H.

    ,

    Naseri

    A.

    ,

    Reyes-Gutierrez

    P.

    ,

    Wolfe

    SA

    ,

    Zhang

    S.

    ,

    T. Peders

    Многоцветное CRISPR-мечение хромосомных локусов в клетках человека

    .

    Proc. Natl. Акад. Sci. США

    2015

    ;

    112

    :

    3002

    3007

    .6.

    Qin

    P.W.

    ,

    Parlak

    M.

    ,

    Kuscu

    C.

    ,

    Bandaria

    J.

    ,

    Mir

    M.

    ,

    Szlachta

    K.

    ,

    R. Singh

    Darzacq

    X.

    ,

    Yildiz

    A.

    ,

    Adli

    M.

    Визуализация живых клеток локусов хромосом с низким и неповторяющимся числом хромосом с использованием CRISPR-Cas9

    .

    Nat. Commun.

    2017

    ;

    8

    :

    14725

    .7.

    Shao

    S.

    ,

    Chang

    L.

    ,

    Sun

    Y.

    ,

    Hou

    Y.

    ,

    Fan

    X.

    ,

    Sun

    Y. Мультиплексная экспрессия sgRNA обеспечивает универсальное мечение одиночной неповторяющейся ДНК и регуляцию эндогенного гена

    .

    ACS Synth. Биол.

    2018

    ;

    7

    :

    176

    186

    .8.

    Gu

    B.

    ,

    Swigut

    T.

    ,

    Spencley

    A.

    ,

    Bauer

    MR

    ,

    Chung

    M.

    ,

    T.

    Wysocka

    J.

    Связанные с транскрипцией изменения ядерной подвижности цис-регуляторных элементов млекопитающих

    .

    Наука

    .

    2018

    ;

    359

    :

    1050

    1055

    .9.

    Wu

    X.

    ,

    Mao

    S.

    ,

    Yang

    Y.

    ,

    Rushdi

    M.N.

    ,

    Krueger

    C.J.

    ,

    Chen

    A.K.

    Гибридная система CRISPR / молекулярного маяка для визуализации генома живых клеток

    .

    Nucleic Acids Res.

    2018

    ;

    46

    :

    e80

    .10.

    Hong

    Y.

    ,

    Lu

    G.

    ,

    Duan

    J.

    ,

    Liu

    W.

    ,

    Zhang

    Y.

    Сравнение и оптимизация систем мечения генома CRISPR / dCas9 / gRNA для визуализации живых клеток

    .

    Genome Biol.

    2018

    ;

    19

    :

    39

    .11.

    Тяги

    S.

    ,

    Kramer

    F.R.

    Молекулярные маяки: зонды, флуоресцирующие при гибридизации

    .

    Nat. Biotechnol.

    1996

    ;

    14

    :

    303

    308

    .12.

    Bao

    G.

    ,

    Rhee

    W.J.

    ,

    Tsourkas

    A.

    Флуоресцентные зонды для обнаружения РНК живых клеток

    .

    Annu. Преподобный Биомед. Англ.

    2009

    ;

    11

    :

    25

    47

    . 13.

    Ma

    Z.

    ,

    Wu

    X.

    ,

    Krueger

    C.J.

    ,

    Chen

    A.K.

    Разработка новых конструкций молекулярных маяков для изучения динамики и локализации внутриклеточной РНК

    .

    Геномика Протеомика Биоинформатика

    .

    2017

    ;

    15

    :

    279

    286

    . 14.

    Zheng

    J.

    ,

    Yang

    R.

    ,

    Shi

    M.

    ,

    Wu

    C.

    ,

    Fang

    X.

    ,

    Li

    Y. Li

    J.

    ,

    Tan

    W.

    Рационально разработанные молекулярные маяки для биоаналитических и биомедицинских приложений

    .

    Chem. Soc. Ред.

    2015

    ;

    44

    :

    3036

    3055

    . 15.

    Santangelo

    P.J.

    ,

    Nix

    B.

    ,

    Tsourkas

    A.

    ,

    Bao

    G.

    Двойные молекулярные маяки FRET для обнаружения мРНК в живых клетках

    .

    Nucleic Acids Res.

    2004

    ;

    32

    :

    e57

    . 16.

    Цуркас

    A.

    ,

    Behlke

    M.A.

    ,

    Xu

    Y.

    ,

    Bao

    G.

    Спектроскопические характеристики двойных флуоресцентных / люминесцентных резонансных молекулярных маяков с переносом энергии

    .

    Анал. Chem.

    2003

    ;

    75

    :

    3697

    3703

    . 17.

    van den Bogaard

    P.T.

    ,

    Tyagi

    S.

    Использование молекулярных маяков для изучения распространения мРНП из локуса гена

    .

    Methods Mol.Биол.

    2009

    ;

    464

    :

    91

    103

    . 18.

    Чен

    М.М.

    ,

    млн лет

    Z.

    ,

    Wu

    X.T.

    ,

    Mao

    S.Q.

    ,

    Ян

    Ю.Т.

    ,

    Tan

    J.

    ,

    Krueger

    C.J.

    ,

    Chen

    A.K.

    Подход на основе молекулярных маяков для визуализации транскриптов РНК на живых клетках с минимальной инженерией мишеней на уровне одной молекулы

    .

    Sci. Отчет

    2017

    ;

    7

    :

    1550

    .19.

    Чжао

    Д.

    ,

    Ян

    Ю.Т.

    ,

    Qu

    N.

    ,

    Chen

    M.M.

    ,

    Ma

    Z.

    ,

    Krueger

    C.J.

    ,

    Behlke

    MA

    ,

    Chen

    A.K.

    Обнаружение одной молекулы и отслеживание транскриптов РНК в живых клетках с использованием оптимизированных фосфоротиоатом молекулярных маяков 2′-O-метил РНК

    .

    Биоматериалы

    .

    2016

    ;

    100

    :

    172

    183

    .20.

    Чен

    А.К.

    ,

    Behlke

    M.A.

    ,

    Tsourkas

    A.

    Эффективная цитозольная доставка конъюгатов молекулярных маяков и проточно-цитометрический анализ целевой РНК

    .

    Nucleic Acids Res.

    2008

    ;

    36

    :

    e69

    . 21.

    Шинделин

    J.

    ,

    Арганда-Каррерас

    I.

    ,

    Frize

    E.

    ,

    Kaynig

    V.

    ,

    Longair

    M.

    ,

    Pietzsch

    T.

    ,

    Preibisch

    S.

    ,

    R

    Saalfeld

    S.

    ,

    Schmid

    B.

    et al. .

    Fiji: платформа с открытым исходным кодом для анализа биологических изображений

    .

    Nat. Методы

    .

    2012

    ;

    9

    :

    676

    682

    .22.

    Chen

    B.

    ,

    Zou

    W.

    ,

    Xu

    H.

    ,

    Liang

    Y.

    ,

    Huang

    B.

    Эффективная маркировка белков и визуализация -кодирование генов в живых клетках с использованием CRISPR-Tag

    .

    Nat. Commun.

    2018

    ;

    9

    :

    5065

    . 23.

    Hunenberger

    P.H.

    ,

    Mark

    A.E.

    ,

    Vangunsteren

    W.F.

    Флуктуационный и кросс-корреляционный анализ белковых движений, наблюдаемых в наносекундном молекулярно-динамическом моделировании

    .

    J. Mol. Биол.

    1995

    ;

    252

    :

    492

    503

    . 24.

    Тарантино

    N.

    ,

    Tinevez

    J.Y.

    ,

    Crowell

    E.F.

    ,

    Boisson

    B.

    ,

    Henriques

    R.

    ,

    Mhlanga

    M.

    ,

    Agou

    F.

    ,

    Israel

    A.

    ,

    Laplantine

    E.

    TNF и IL-1 проявляют различные потребности в убиквитине для индукции супрамолекулярных структур NEMO-IKK

    .

    J. Cell Biol.

    2014

    ;

    204

    :

    231

    245

    0,25.

    Негембор

    М.В.

    ,

    Sebastian-Perez

    R.

    ,

    Aulicino

    F.

    ,

    Gomez-Garcia

    P.А.

    ,

    Косма

    М.П.

    ,

    Lakadamyali

    M.

    (Po) STAC (полицистронный SunTAg, модифицированный CRISPR) обеспечивает визуализацию нескольких генов в сверхвысоком разрешении живых и фиксированных клеток

    .

    Nucleic Acids Res.

    2018

    ;

    46

    :

    e30

    .26.

    Soutoglou

    E.

    ,

    Misteli

    T.

    Подвижность и неподвижность хроматина в транскрипции и стабильность генома

    .

    Curr. Opin. Genet. Dev.

    2007

    ;

    17

    :

    435

    442

    . 27.

    Lanctot

    C.

    ,

    Cheutin

    T.

    ,

    Cremer

    M.

    ,

    Cavalli

    G.

    ,

    Cremer

    T.

    Архитектура динамического пространства: динамическое пространство генома регулирование экспрессии генов в трех измерениях

    .

    Nat. Преподобный Жене.

    2007

    ;

    8

    :

    104

    115

    .28.

    Sahl

    S.J.

    ,

    Ад

    S.W.

    ,

    Jakobs

    S.

    Флуоресцентная наноскопия в клеточной биологии

    .

    Nat. Rev. Mol. Cell Biol.

    2017

    ;

    18

    :

    685

    701

    . 29.

    Коэн

    S.

    ,

    Valm

    A.M.

    ,

    Lippincott-Schwartz

    J.

    Мультиспектральная визуализация живых клеток

    .

    Curr.Protoc. Cell Biol.

    2018

    ;

    79

    :

    e46

    .

    © Автор (ы) 2019. Опубликовано Oxford University Press от имени Nucleic Acids Research.

    Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинал работа правильно процитирована.

    границ | Конверсия цитохрома P450 2D6 человека в инструмент на основе FRET для мониторинга аймалицина в живых клетках в реальном времени

    Введение

    Аджмалицин, природный монотерпеноидный индольный алкалоид, представляет собой биоактивное соединение, хорошо известное своей антигипертензивной и антимикробной активностью (Moreno et al., 1995; Дас и Сатьяпракаш, 2018). Он также используется для снятия обструкции церебрального кровотока и продемонстрировал свой потенциал при лечении болезней системы кровообращения (Misra et al., 2006). Адренергическая блокировка и центральная депрессивная активность этого алкалоида была оценена Bhargava и Borison (1957). Сообщалось также о цитотоксической активности аджмалицина (Dey and De, 2012). Ранее предполагалось, что аджмалицин, наряду с другими гетероохимбиновыми алкалоидами, действует как предшественник различных оксиндольных алкалоидов, которые проявляют множество биологических активностей (Stavrinides et al., 2016). Кора корня R. serpentina и C. roseus , являющихся значительными источниками аджмалицина, была неизбирательно использована для экстенсивного извлечения аджмалицина из-за его высокого спроса (Zheng and Wu, 2004; Mallick et al., 2012; Fulzele, Namdeo, 2018). Кроме того, низкое содержание алкалоидов в растениях требует использования природных источников в больших количествах. В то же время значительное истощение природных источников исследовало вопрос, вызывающий озабоченность окружающей среды (Zafar et al., 2019). Следовательно, требуется устойчивое и увеличенное производство за счет тщательного изучения метаболических взаимодействий, участвующих в синтезе алкалоидов. Предыдущие попытки повысить продуктивность аджмалицина с помощью культур клеточных суспензий, культур во встряхиваемых колбах, культур волосатых корней, методов выявления и лабораторных подходов, несомненно, способствовали повышению урожайности (Schlatmann et al., 1993; ten Hoopen et al., 1994; Альмагро и др., 2010). Однако возможность реализации достижений в более крупном масштабе сталкивается с трудностями, связанными с непомерно высокими затратами и трудозатратами.Учитывая нынешние блокады на пути повышения продуктивности алкалоидов, флуксомическое исследование могло бы щедро разрешить проблему, определив регуляторные элементы, влияющие на поток в метаболическом пути. Флюксомный подход к мониторингу аджмалицина in vivo и может быть многообещающим в области исследований для понимания сложного взаимосвязанного клеточного метаболизма и может справедливо устранить препятствия, связанные с его низким выходом и производством. Возможность контролировать поток аджмалицина в реальном времени может быть предоставлен наносенсором FRET, разработанным в настоящем исследовании.Это обещает обеспечить высокое пространственное и временное разрешение при изучении потока аджмалицина. На сегодняшний день наносенсоры FRET были успешно разработаны для in vivo исследования различных аналитов, таких как лизин (Ameen et al., 2016), глицин бетаин (Ahmad et al., 2016), цинк (Mohsin et al., 2015 ), глюкозу (Fehr et al., 2003), глутамат (Okumoto et al., 2005) и рибозу (Lager et al., 2003). Учитывая потребность в инструменте, который может выполнять поток аджмалицина в живую систему в реальном времени, в этом исследовании был разработан генетически кодируемый наносенсор на основе FRET.

    Наносенсоры FRET следуют общей конструкции, состоящей из сэндвича с анализируемым специфическим лиганд-связывающим белком между донорными и акцепторными флуоресцентными белками. Выбор лиганд-связывающего белка осуществляется на основе его способности претерпевать конформационные изменения в присутствии целевого аналита. Измененная конформация связывающего лиганд белка путем связывания целевого аналита приводила к передаче безызлучательной энергии от донорного флуоресцентного белка к акцепторному флуоресцентному белку (пара FRET), демонстрируя измененную интенсивность излучения флуорофоров.Наносенсор использует переменную интенсивность излучения в качестве меры изменения концентрации метаболита, помогая в исследовании потока. Прелесть этих генетически закодированных наносенсоров на основе FRET заключается в том, что мониторинг метаболитов может выполняться в любом типе клеток и многократно.

    Материалы и методы

    Разработка химерной конструкции

    Человеческий цитохром P450 2D6, связывающий аймалицин белок, был использован в качестве элемента для связывания аджмалицина для разработки наносенсора.Структура белка была проанализирована с использованием RCSB PDB (PDB ID-4WNT, разрешение 2,6 Å), и нуклеотидная последовательность гена (CYP2D6), кодирующего белок, была получена из KEGG (KEGG Entry-1565). КДНК человеческого CYP2D6 была приобретена в Sinobiologicals Inc., и амплификация гена была достигнута с использованием набора из двух праймеров: 5′- accggt cccctggccgtgatagtggccatctt-3 ‘(FP) и 5’- ccggt ctagcggggcacagcacaaa (RP), содержащий сайты рестрикции Age I, обозначенные здесь курсивом.Кроме того, вектор pDh28 был использован для амплификации нуклеотидных последовательностей ECFP и Венеры, причем праймеры были сконструированы для добавления сайтов attB 1 и attB 2 на 5′-конце ECFP и 3′-конце Венеры, соответственно. Затем сайты рестрикции Age I, содержащие ген CYP2D6, лигировали между 3 ‘концом ECFP и 5’ концом Венеры, получая химерную последовательность ECFP_CYP2D6_Venus, клонированную в векторе pGEM-Teasy (Promega, США). Затем рекомбинантную химерную последовательность вводили в вектор pRSET B (Novagen, Германия) рестрикционным расщеплением по сайтам Bam HI и Hin dIII.Разработанная рекомбинантная конструкция pRSET-B_ECFP_CYP2D6_Venus была обозначена как FLIP-Ajn (флуоресцентный индикаторный белок аймалицина). Клонированную конструкцию дополнительно вводили в векторы экспрессии дрожжевых (pYES-DEST52), растительных (pEarleyGate100) и животных клеток (pCDNA-DEST-40) с использованием технологии клонирования Gateway (Invitrogen, США). Первоначально pRSET-B_ECFP_CYP2D6_Venus был перемещен к pDONR222 в реакции рекомбинации, опосредованной BP, для создания входного клона (pDONR222_ECFP_CYP2D6_Venus).PDONR222_ECFP_CYP2D6_Venus был дополнительно переведен на pYES-DEST52, pEarleyGate100 и pCDNA-DEST-40, генерирующие клоны экспрессии, pYES-DEST52_ECFP_CYP2D6_Venus, pEarleyGate100_ECFP_CYP2D6_Venus и pEarleyGate100_ECFP_CYP2D6_Venus, с использованием реакции pEarleyGate100_ECFP_CYP2D6_Venus и pEarleyGate100_ECFP_CYP2D6_Venus и pEarleyGate100_ECFP_CYP2D6_Venus-mediated response. Для проверки конструкции рекомбинации был принят анализ секвенирования (рисунок S1).

    Экспрессия и очистка наносенсорного белка

    Конструкцию FLIP-Ajn трансформировали в клетки Escherichia coli BL21 (DE3) и оставляли для роста при 21 ° C в течение 24 часов для экспрессии.Рост клеток продолжался до O.D. 600 ~ 0,6. Впоследствии экспрессия была инициирована путем добавления синтетического аналога аллолактозы — изопропил-β-D-1-тиогалактопиранозида (IPTG). Индуцированные клетки выдерживали в шейкере инкубатора при 21 ° C в течение 48 ч, колбу накрывали и помещали в темные условия. Затем культуру центрифугировали при 4500 × g при 4 ° C в течение 15 минут, и растворение осадка выполняли с помощью 20 мМ трис-Cl (pH 7,5). После этого была проведена обработка клеток ультразвуком для высвобождения белка наносенсора.Белок наносенсора был отделен от клеточного дебриса центрифугированием при 7800 об / мин в течение 30 мин. Сначала супернатанту давали связываться с Ni-NTA агарозной смолой (Qiagen, Германия) в течение 3 ч в чашке Петри и выдерживали при 4 ° C. Затем белок дважды промывали в аффинной колонке с меткой Ni-NTA His ледяным буфером, содержащим 20 мМ трис-Cl, pH 7,5 и 20 мМ имидазол. Наконец, элюцию белка проводили 20 мМ трис-Cl, pH 7,5 и 250 мМ имидазолом, и хранили для дальнейшего исследования.

    Характеристики наносенсора

    Характеристику наносенсора проводили с помощью микропланшетного ридера (Synergy h2, Biotek, США). Первоначально спектральный анализ наносенсора проводился путем измерения интенсивности излучения ECFP и Венеры. ECFP подвергали возбуждению с длиной волны 430 нм, и излучение регистрировали посредством спектрального сканирования между 450 и 600 нм с интервалом 10 нм в присутствии и в отсутствие аджмалицина. После спектрального анализа были изучены зависимость от pH, специфичность и сродство наносенсора.Фильтры / щели, используемые для анализа, были 430 нм / 20 нм для возбуждения ECFP, 485 нм / 20 нм для испускания ECFP и 540 нм / 20 нм для испускания Венеры. Элюированный белок разводили в 20 раз в различных буферных системах, а именно, Tris-Cl, PBS, TBS и MOPS в диапазоне pH 5,5–7,5 для анализа зависимости pH и оптимальной буферной системы для характеристики наносенсора. Тестирование специфичности разработанного наносенсора проводили путем добавления 10 мМ различных ингибиторов / субстратов CYP2D6 к FLIP-Ajn.Эти соединения представляли собой резерпин, резциннамин, винбластин, винкристин, хинидин, серпентин, тиоридазин и хинин. Сродство наносенсора осуществляли путем титрования белка наносенсора при различных концентрациях аджмалицина. Значение, полученное из отношения интенсивностей излучения Венеры / ECFP (отношение FRET) при связывании лиганда, обеспечивает меру концентрации субстрата. Аффинность связывания аджмалицина (значение K d ) определяли, применяя следующее уравнение к кривым титрования лиганда:

    S = (r — r апо ) / (r sat — r apo ) = [L] / ( K d + [L]), где S означает насыщение; [L] для концентрации аджмалицина; r для соотношения; r апо представляет собой соотношение без аймалицина и r сат с аджмалицином.

    Мониторинг аймалицина в реальном времени

    Бактериальные клетки

    Разработанную рекомбинантную конструкцию pRSET-B_ECFP_CYP2D6_Venus (FLIP-Ajn) вводили в клетки E.coli BL21 (DE3) и выращивали при 37 ° C (150 об / мин) в шейкере-инкубаторе до достижения O.D. 600 бактериального роста достигло 0,6. Затем клетки обрабатывали 0,5 мМ IPTG и выдерживали в течение 24 часов при 21 ° C при непрерывном встряхивании для экспрессии белка наносенсора. Мониторинг содержания аджмалицина в бактериальных клетках в реальном времени осуществляли путем добавления 10 мМ аджмалицина к бактериальной культуре, помещенной в многолуночные планшеты.Отношения интенсивностей излучения Венеры / ECFP регистрировались в течение 30 минут, а данные собирались каждые 5 минут. Контрольный эксперимент включает бактериальные клетки без аджмалицина. Используемые фильтры / щели возбуждения были такими же, как описано в предыдущем анализе.

    Дрожжевые клетки

    Клонированная шлюзом pYES-DEST_ECFP_CYP2D6_Venus была трансформирована в штамм BY4247 Saccharomyces cerevisiae / URA3 . Трансформированные дрожжевые клетки культивировали в синтетической среде определенного (SD), содержащей декстрозу (2%) в качестве источника углерода и галактозу (1%) для индукции.Экспрессированные дрожжевые клетки подвергали конфокальному микроскопическому анализу с использованием сканирующей головки Leica TCS-SPE и линзы объектива 63x с системой масляной иммерсии. В экспрессированную культуру вводили 10 мМ аджмалицина. Отношения интенсивностей излучения Венеры / ECFP регистрировались в течение 10 мин, а данные собирались каждые 20 с.

    Клетки животных

    Клетки HEK-293T (эмбриональная почка человека) культивировали в среде Игла, модифицированной Дульбекко, содержащей 50 мкг / мл ампициллина, 10% фетальной телячьей сыворотки и CO 2 , в шейкере-инкубаторе при 37 ° C.Опосредованную фосфатом кальция временную трансфекцию клеток HEK-293T с помощью pCDNA_ECFP_CYP2D6_Venus проводили в 6-луночном культуральном планшете и давали возможность экспрессироваться в течение 2 дней. Промывочный буфер состоял из 50 мМ NaCl, 1 мМ MgCl 2 , 5 мМ KCl, 5 мМ D-глюкозы и 25 мМ HEPES (pH 7,2–7,4). После перерыва в 2 дня после трансфекции культивированные клетки были настроены для анализа изображений с использованием конфокального микроскопа с числовой апертурой 1,53, охлаждаемой камеры с зарядовой связью и иммерсионного объектива 63x.В культуру добавляли 10 мМ аджмалицина и снимали изображения. Отношения интенсивностей излучения Венеры / ECFP регистрировались в течение 10 мин. Настройка лазера, используемая для анализа, была одинаковой как для дрожжевых, так и для животных клеток. Данные собирались через интервал в 20 с, а время экспозиции, установленное для получения изображений, составляло 300 мс.

    Растительные клетки

    Эксплантаты листьев были использованы в исследовании для инициации каллуса. Сегменты листьев Catharanthus roseus были собраны из травяного сада Джамия Хамдард, Нью-Дели.Затем собранные эксплантаты промывали непрерывно в течение 20 мин под водопроводной водой. Затем эксплантаты обрабатывали 0,5% цетримидом и 0,1% HgCl 2 в течение 10 и 5 минут соответственно. Далее проводили последовательную промывку 70% спиртом и стерилизованной дистиллированной водой в течение 1 мин. Культивирование стерильных эксплантатов проводили на среде MS (Murashige and Skoog, 1962), содержащей 0,5 мкМ 2,4-D, 3% сахарозы и 0,62% агара. PH среды поддерживали на уровне 5,65, а пробирки для культивирования хранили в культуральной комнате при 25 ± 2 ° C.

    Agrobacterium tumefaceins штамм EHA105 трансформировали pEarleyGate100_ECFP_CYP2D6_Venus, и культивирование суспензии инициировали после инокуляции одной колонии трансформированного штамма Agrobacterium в среду LB. В среду добавляли 50 мг / мл канамицина и 50 мг / мл рифампицина, и культуру поддерживали при 28 ° C в течение 36 часов. Затем осуществляли трансформацию каллусных клеток, добавляя линии каллуса, хранящиеся в культуральной комнате, к суспензионной культуре клеток агробактерий.Культуре позволяли расти при 28 ° C (150 об / мин) до OD. 600 0,6. Затем эксплантаты сушили с помощью стерильной фильтровальной бумаги и совместно культивировали в течение 3 дней на МС + 100 мкМ ацетосирингон при 25 ± 2 ° C. После этого эксплантаты промывали сначала цефотаксимом 500 мг / л, а затем дважды стерильной дистиллированной водой. Им снова давали возможность высохнуть и затем переносили в среду отбора, содержащую MS, 10 мг / л BASTA, 250 мг / л цефотаксима и 0,5 мкМ 2,4-D. Впоследствии цефотаксим и антибиотик были дополнительно удалены из среды, и культура поддерживалась при 16-часовом фотопериоде при 25 ± 2 ° C.

    Суспензионную культуру Catharanthus roseus , трансформированную pEarleyGate100_ECFP_CYP2D6_Venus, наблюдали под конфокальным микроскопом Leica с 10-кратным объективом. Культуру подвергали флуоресцентному анализу, и соотношение интенсивностей эмиссии Венеры / ECFP регистрировали после возбуждения при 430 нм. Визуализация осуществлялась с использованием отдельных фильтров возбуждения и излучения. Использовали возбуждающий фильтр 430 нм, а для исследования использовали эмиссионные фильтры 485 нм и 540 нм.Для регистрации отношения интенсивностей излучения FRET использовалась программа LAS-AF (Leica, Германия).

    Развитие аффинных мутантов

    Для расширения физиологического диапазона наносенсора аминокислоты лиганд-связывающего кармана аймалицин-связывающего белка были точечно мутированы с использованием набора для сайт-направленного мутагенеза с быстрой заменой (Stratagene, США). Точечные мутации были внесены в разные сайты. Фенилаланин в положении 120 был заменен аргинином (F120R), лизин в положении 213 был заменен аланином (L213A), глицин в положении 212 был заменен глутамином (G212Q), а аспарагиновая кислота в положении 301 была заменена глицином (D301G).Очистку экспрессии и анализ аффинности разработанных мутантов проводили, как описано в предыдущем разделе.

    Результаты

    Проектирование и изготовление нанодатчика

    Цитохром P450 2D6 был успешно преобразован в сенсорный домен аджмалицина. Связывание аджмалицина с сайтом связывания лиганда белка индуцировало структурные изменения в белке и способствовало безызлучательному переносу энергии между флуоресцентной парой, ECFP и Венерой.N- и C-конец CYP2D6 был присоединен к флуоресцентным фрагментам (ECFP и Venus) для удовлетворения потребности в FRET (Рисунок 1). Успешное развитие рекомбинантной конструкции в векторах экспрессии, включая pRSET-B, было подтверждено рестрикционным перевариванием, как показано на фигурах S1-S11, и дальнейшее подтверждение было достигнуто с помощью анализа нуклеотидного секвенирования (фигуры S1, S13).

    Рисунок 1 . Схематическое изображение конструкции наноснор. (A) Эскиз сконструированного нанонаносенсора. (B) Схема, описывающая работу FLIP — Ajn. Реакция FRET наблюдается после введения аджмалицина в систему.

    Спектральный анализ нанодатчика

    Экспрессия белка наносенсора была подтверждена с помощью спектрального анализа. Повышенная интенсивность излучения Венеры была зарегистрирована в присутствии 1 мМ аджмалицина (рис. 2). В отсутствие аджмалицина интенсивность излучения 140 и 200 а.е. регистрировали при 480 и 540 нм соответственно.Аналогичным образом, данные флуоресцентного анализа, полученные при добавлении аджмалицина к белку наносенсора, показали снижение интенсивности излучения на 120 а.е. около 480 нм и повышенной интенсивности флуоресценции до 230 а.е. около 540 нм (рисунок 2). Изменение соотношения интенсивностей эмиссии Венеры / ECFP в присутствии и в отсутствие аджмалицина само по себе означало наличие FRET между ECFP и Венерой.

    Рисунок 2 . Интенсивность излучения флуоресценции регистрировали на микропланшетном ридере в отсутствие и в присутствии 1 мМ аджмалицина.Показано улучшение интенсивности флуоресценции Венеры.

    Эксперимент по титрованию, проведенный с белком наносенсора и аджмалицином в диапазоне от наномолярного до миллимолярного, показал насыщение белка повышенной концентрацией аджмалицина. Сигмоидальная кривая была получена с помощью графика данных, где увеличение отношения FRET от 0,7 до 1,05 наблюдалось при увеличении концентрации аджмалицина, а насыщение белка регистрировалось с помощью 1 мМ аджмалицина (фиг. 3).Аффинность связывания лиганда ( K d ) FLIP-Ajn была рассчитана как 582 мкМ. Концентрация белка наносенсора составила 0,20 мг / мл.

    Рисунок 3 . Сигмоидальный график представляет насыщение FLIP-Ajn при увеличении концентрации аджмалицина. Эксперимент проводили с тремя независимыми повторами. Вертикальные полосы показывают стандартную ошибку набора данных.

    Анализ стабильности pH датчика

    Анализ стабильности pH in vitro подтвердил отсутствие влияния pH на ожидаемый выход белка наносенсора.Белок наносенсора был стабилен во всех буферах, выбранных для анализа, а именно, Tris-Cl, PBS, TBS и MOPS. Однако лучший результат был получен в буфере PBS (pH 7,0). Очищенный белок не показал изменений в соотношении FRET с показателем около 1,1 в отсутствие аджмалицина. Однако после добавления аджмалицина в буферную систему PBS была зафиксирована заметная разница в соотношении FRET. Не наблюдалось значительного изменения соотношения FRET от pH 5,5 до pH 7,0 (рис. 4).

    Рисунок 4 .На рисунке показан анализ pH-стабильности FLIP-Ajn. Очищенный белок растворяли в буфере PBS с различным pH и отслеживали изменение соотношения FRET. Черная и желтая линии показывают соотношение FRET, определенное в присутствии и в отсутствие аджмалицина (Ajn). Построенные на графике значения представляют собой среднее значение трех независимых повторов. Вертикальные полосы указывают стандартную ошибку.

    Анализ специфичности нанодатчика

    Элюированный белок наносенсора, подвергнутый анализу специфичности, показал значительное изменение отношения FRET в присутствии аджмалицина по сравнению с контролем.Коэффициент FRET 1,1 был зарегистрирован для белка наносенсора при добавлении 10 мМ аджмалицина. Не было обнаружено значительного изменения соотношения FRET для FLIP-Ajn при добавлении различных субстратов / ингибиторов CYP2D6 (рис. 5), за исключением присутствия хинидина и серпентина, где изменение соотношения FRET составляло ~ 0,12 и ~ 0,14 относительно контроля. . Однако это несущественно, так как изменение отношения FRET <0,2. Этот анализ подтвердил специфичность CYP2D6 в отношении одного аджмалицина.

    Рисунок 5 .Анализ лигандной специфичности FLIP-Ajn. Повышенное соотношение FRET по сравнению с контролем, наблюдаемое для одного аджмалицина. Исследование было выполнено с тремя независимыми повторностями. Вертикальные полосы показывают стандартную ошибку набора данных.

    Мутанты FLIP-Ajn

    Четыре мутанта FLIP-Ajn были разработаны с разным сродством с помощью сайт-направленного мутагенеза. Различные наносенсоры обладают разной аффинностью связывания и имеют широкий диапазон концентраций от 24 мкМ до 4500 мкМ (таблица 1).Аффинность связывания ( K d ) для наносенсора дикого типа (WT) была рассчитана как 582 мкМ. Аналогичным образом были рассчитаны константы связывания мутантов. K d значения для F120R, L213A, G212Q и D301G были рассчитаны как 700, 3000, 38 и 24 соответственно. Максимальные изменения отношения FRET 0,52 наблюдались в F120R (Рисунок 6).

    Таблица 1 . Аффинные мутанты FLIP-Ajn.

    Рисунок 6 . Сигмоидальный график представляет собой насыщение наносенсора дикого типа (WT) и аффинных мутантов наносенсора (F120R, L213A, G212Q и D301G) при увеличении концентрации аджмалицина.Исследование было выполнено с тремя независимыми повторностями. Вертикальные полосы показывают стандартную ошибку набора данных.

    Мониторинг потока аджмалицина в прокариотических и эукариотических системах в реальном времени

    Прокариотические (бактерии) и эукариотические (дрожжи и животные) системы, выбранные для мониторинга потока аджмалицина в реальном времени, показали повышенное соотношение FRET в присутствии аджмалицина. В бактериальных клетках после внешнего добавления аджмалицина наблюдалось увеличение отношения FRET с 0,2 до 0,4 (рис. 7).Точно так же данные конфокальной визуализации, полученные для потока аджмалицина в дрожжевых клетках в реальном времени, показали увеличение отношения FRET с 0,65 до 1,61 в течение 10 минут после добавления аджмалицина в культуру (рис. 8). Трансфицированные клетки HEK-293T также показали изменение отношения FRET от 0,4 ± 0,05 в 0 с до 0,85 ± 0,05 через 400 с после добавления аджмалицина, а данные визуализации показали распределение белка наносенсора в основном в цитоплазме культивируемых растений. ячеек (рисунок 9). Клетки Catharanthus roseus , трансформированные pEarleyDate100_ECFP_CYP2D6_Venus, экспрессируются в цитозоле растительных клеток.Медленное и последовательное добавление аджмалицина к суспензионной культуре привело к увеличению отношения FRET с 0,7 до 3,9 (фиг.10). Не наблюдалось значительного увеличения соотношения FRET в отсутствие аджмалицина, но добавление более высоких концентраций аджмалицина давало данные с высокими изменениями соотношения FRET. Изменившееся соотношение интенсивности излучения свидетельствует о поглощении аджмалицина растительными клетками.

    Рисунок 7 . Динамика аймалицина в клетках бактерий в живых клетках.Линейный график показывает увеличение отношения FRET на ~ 0,24 после добавления 10 мМ аджмалицина. Исследование было выполнено с тремя независимыми повторностями. Вертикальные полосы показывают стандартную ошибку набора данных.

    Рисунок 8 . Мониторинг потока аджмалицина в дрожжевых клетках. (A) Конфокальные изображения дрожжевых клеток, экспрессирующих наносенсорный белок. Изображения представляют собой ECFP, Венеру и объединенную флуоресценцию. (B) Интенсивности испускания FRET FLIP-Ajn, экспрессированного в дрожжевых клетках.Повышенное соотношение FRET ~ 1 зарегистрировано при добавлении 10 мМ аджмалицина.

    Рисунок 9 . Мониторинг потока аджмалицина в клетках млекопитающих. (A) Конфокальная визуализация трансформированных FLIP-Ajn клеток млекопитающих, отображающая изображения яркого поля, ECFP и Венеры. (B) Изменение соотношения FRET, наблюдаемое в трансформированных клетках HEK-293T. Увеличение соотношения FRET с 0,4 до 1,08 зафиксировано при добавлении аджмалицина в культуру.

    Рисунок 10 .Изменение соотношения FRET в трансформированных клетках Catharanthus roseus , экспрессирующих наносенсорный белок. Сообщается о значительном увеличении интенсивности излучения Венеры в течение 20 минут.

    Обсуждение

    Предпосылки для генетически кодируемого наносенсора FRET требуют конформационной гибкости лиганд-связывающего белка, которая должна быть достаточной, чтобы вызывать перенос энергии между прикрепленными флуорофорами (Fehr et al., 2002). Цитохром P450 2D6 связывается с аджмалицином, что приводит к изменению открытой структуры белка в результате образования водородной связи Glu-216 с аджмалицином, как сообщалось Wang et al.(2015). Структурные изменения решетки цитохрома P450 2D6 с аджмалицином и без него отражены в дополнительном файле. Об ингибирующем воздействии аджмалицина и серпентина на CYP2D6 впервые сообщили Usia et al. (2005). Работа FRET-наносенсора не зависит от активности CYP2D6 из-за ингибирующих эффектов аджмалицина, серпентина и различных субстратов / ингибиторов, выбранных для исследования. Для работы наносенсора необходимы только конформационные изменения CYP2D6 при связывании аджмалицина, независимо от результирующей ферментативной активности белка.Конформационные различия, возникающие в связывающем аймалицине белке из-за добавления аджмалицина, были достаточными для индукции FRET между ECFP и Венерой, как показано на рисунке 2. Хотя тиоридазин, хинидин и хинин вызывают конформационные изменения в домене CYP2D6, как сообщает Ван. и другие. (2015), изменение соотношения FRET, наблюдаемое в присутствии этих субстратов, не было значительным, поскольку изменение соотношения FRET составляет <0,2 (Рисунок 5). Возникновение FRET также зависит от выбора донорных / акцепторных флуорофоров.Пара флуорофоров должна иметь достаточное спектральное перекрытие для эффективной передачи энергии, но при этом иметь тривиальные различия в спектрах, чтобы их можно было отличить друг от друга (Held, 2005). Связывание аджмалицина с цитохромом P450 2D6 согласовывало ECFP и Венеру, что приводило к безызлучательному переносу энергии между флуоресцентной парой, что наблюдалось по измененной интенсивности излучения пары FRET. Измерение соотношения FRET, основанное на интенсивности излучения донорных и акцепторных флуорофоров, ранее проводилось для мониторинга аминокислот (Hu et al., 2017), в исследовании также делается вывод об отсутствии помех pH, налагаемых на аффинность наносенсора, что делает его пригодным для мониторинга уровня аймалицина in vivo . Исследование также подтверждает специфичность наносенсора только в отношении аджмалицина, что подтверждается значительным увеличением соотношения FRET для FLIP-Ajn в присутствии аджмалицина (рис. 5).

    FLIP-Ajn доказал свою превосходную способность контролировать уровень аджмалицина в реальном времени. Белок наносенсора успешно экспрессируется в клетках бактерий, дрожжей, животных и растений, и ожидаемое изменение соотношения FRET, наблюдаемое в исследуемых системах, подтвердило успешную разработку наносенсора.Одной из приоритетных задач разработанного наносенсора было обнаружение динамики метаболитов с высоким пространственным и временным разрешением в живых клетках. В целом, FLIP-Ajn продемонстрировал свою экспрессию в цитозоле дрожжевых клеток и цитоплазме клеток животных, как показано на фиг. 8, 9. FLIP-Ajn также успешно экспрессировался в цитозоле растительных клеток. Дальнейшее добавление нацеливающих последовательностей к белку наносенсора позволит визуализировать различные субкомпартменты клеток и повысит нашу способность контролировать путь, участвующий в производстве аджмалицина.Нацеливание наносенсорного белка на субклеточные компартменты ранее достигалось с помощью ряда FRET-наносенсоров, а именно, FLIPglu в ядрах (Fehr et al., 2004). Созданные мутанты FRET-наносенсора также расширили возможности обнаружения наносенсора и, следовательно, обеспечивают его полезность для измерения уровней аджмалицина в широком физиологическом диапазоне.

    Заключение

    В исследовании сообщается о развитии белка-индикатора флуоресценции аймалицина посредством сэндвича CYP2D6 между парой FRET (ECFP и Venus).Было обнаружено, что наносенсор стабилен при pH ≥ 7,0, специфичен для аймалицина, т.е. не реагирует на выбранные ингибиторы / субстраты CYP2D6, а аффинность связывания белка наносенсора была рассчитана как 582 мкМ. Экспрессия наносенсорного белка была продемонстрирована в клетках E. coli BL21, Saccharomyces cerevisiae / URA3 штамма BY4247, клетках эмбриональной почки человека (HEK-293T) и суспензионных клетках Catharanthus roseus с помощью флуоресцентного анализа в присутствии аджмалицин.В ходе исследования также были разработаны различные мутанты CYP2D6 посредством сайт-направленного мутагенеза, в результате чего был получен набор наносенсоров с различной аффинностью связывания, которые были бы эффективны для измерения уровней аджмалицина в широких диапазонах концентраций. Наносенсор на основе FRET для аджмалицина, FLIP-Ajn, оказался полезным инструментом для изучения потока аджмалицина в живых клетках в реальном времени. Экспрессия наносенсора в четырех различных хозяевах, представляющих прокариотические и эукариотические микроорганизмы, а также в клетках животных и растений, успешно использованных в исследовании, позволила контролировать поток метаболита.Неинвазивность и высокое пространственное и временное разрешение инструмента имеют большое значение в био-визуализации сильно разветвленных метаболических путей. Присоединение сигнальных пептидов к наносенсору для экспрессии в определенных компартментах растительных клеток откроет новые двери в понимании сложного пути, действующего в природе. Изучение потока аджмалицина также поможет в определении регуляторных этапов, участвующих в синтезе алкалоида, и, следовательно, эффективно улучшит скорость производства аджмалицина из его природных источников.

    Заявление о доступности данных

    Все наборы данных, созданные для этого исследования, включены в статью / дополнительные материалы.

    Авторские взносы

    GA, AA и MA предусмотрели и разработали эксперименты. GA и AA провели эксперимент. GA, AAA и EA проанализировали данные. GA, AA, AAA, AH, MA и EA подготовили рукопись. Все авторы читали и одобрили окончательный вариант рукописи.

    Финансирование

    Плата за публикацию оплачивается фондом деканата научных исследований Университета Короля Сауда за поддержку номера исследовательской группы (RGP-271).

    Конфликт интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    GA благодарен Совету по научным и промышленным исследованиям, Govt. Индии для младшего научного сообщества. AAA, AH и EA хотели бы выразить свою искреннюю признательность деканату научных исследований Университета Короля Сауда за финансирование исследовательской группы номер (RGP-271).

    Дополнительные материалы

    Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fbioe.2019.00375/full#supplementary-material

    Список литературы

    Ахмад, М., Амин, С., Сиддики, Т. О., Хан, П., и Ахмад, А. (2016). Мониторинг глицин бетаина в живых клетках с помощью генетически кодируемого наносенсора на основе FRET. Biosens. Bioelec. 86, 169–175. DOI: 10.1016 / j.bios.2016.06.049

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Альмагро, Л., Перес, А. Л., и Педреньо, М. А. (2010). Новый метод увеличения продукции аджмалицина в культурах клеток, основанный на использовании циклодекстринов. Biotechnol. Lett. 33, 381–385. DOI: 10.1007 / s10529-010-0430-6

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Амин С., Ахмад М., Мохсин М., Куреши М. И., Ибрагим М. М., Абдин и др. (2016). Разработка, создание и характеристика генетически закодированного нанонаносенсора на основе FRET для мониторинга потока лизина в живых клетках в реальном времени. J. Nanobiotechnol. 14:49. DOI: 10.1186 / s12951-016-0204-y

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Бхаргава, К. П., и Борисон, Х. Л. (1957). Сравнительные эффекты различных алкалоидов Rauwolfia на центрально вызванные вазопрессорные реакции. J. Pharmacol. Exp. Ther. 119, 395–405.

    PubMed Аннотация | Google Scholar

    Дас А., Сатьяпракаш К. (2018). Антимикробные свойства натуральных продуктов: обзор.Фарма. Innovation J. 7, 532–537.

    Google Scholar

    Дей А. и Де Дж. Н. (2012). Растительные средства против змеиного яда, используемые этническими группами района Пурулия, Западная Бенгалия, Индия. J. Herbs Spices Med. Растения 18, 152–165. DOI: 10.1080 / 10496475.2011.652298

    CrossRef Полный текст | Google Scholar

    Фер М., Фроммер В. Б. и Лалонд С. (2002). Визуализация поглощения мальтозы в живых дрожжевых клетках с помощью флуоресцентных нанонаносенсоров. Proc. Natl. Акад. Sci. США. 99, 9846–9851. DOI: 10.1073 / pnas.142089199

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фер М., Лалонд С., Эрхардт Д. В. и Фроммер В. Б. (2004). Живое изображение гомеостаза глюкозы в ядрах клеток COS-7. J. Fluoresc. 14, 603–609. DOI: 10.1023 / B: JOFL.0000039347.94943.99

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фер, М., Лалонд, С., Лагер, И., Вольф, М.У. и Фроммер У. Б. (2003). Визуализация in vivo динамики поглощения глюкозы в цитозоле клеток COS-7 с помощью флуоресцентных нанонаносенсоров. J. Biol. Chem. 278, 19127–19133. DOI: 10.1074 / jbc.M301333200

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фулзеле, Д. П., Намдео, А. Г. (2018). Рентабельное экспериментальное производство аджмалицина с помощью суспензионных культур клеток Catharanthus roseus в 100-литровом биореакторе. Biotechnol. Дж. 21, 1–15. DOI: 10.9734 / BJI / 2018/43510

    CrossRef Полный текст | Google Scholar

    Held, P. (2005). Введение в технологию флуоресцентного резонансного переноса энергии (FRET) и ее применение в биологических науках. Winooski, VT: Примечание по применению Bio-Tek.

    Google Scholar

    Ху, Х., Гу, Й., Сюй, Л., Цзоу, Ю., Ван, А., Тао, Р. и др. (2017). Генетически закодированный набор инструментов для отслеживания динамики гистидина живых клеток в пространстве и времени. Sci.Отчет 7: 43479. DOI: 10.1038 / srep43479

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Маллик, С. Р., Йена, Р. К., и Самал, К. С. (2012). Быстрое размножение in vitro исчезающего лекарственного растения сарпганда ( Rauwolfia serpentina ). Am. J. Plant Sci. 3, 437–442. DOI: 10.4236 / ajps.2012.34053

    CrossRef Полный текст | Google Scholar

    Мисра, Н., Кумар, С., и Лутра, Р. (2006). Биоконверсия аджмалицина в серпентин в корнях Catharanthus roseus.Дж. Плант. Sci. 1, 340–347. DOI: 10.3923 / jps.2006.340.347

    CrossRef Полный текст | Google Scholar

    Мохсин, М., Диван, Х., Хан, И., и Ахмад, А. (2015). Генетически кодируемый нанонаносенсор на основе FRET для мониторинга концентрации цинка в физиологической среде живой клетки in vivo. Biochem. Англ. J. 102, 62–68. DOI: 10.1016 / j.bej.2015.03.012

    CrossRef Полный текст | Google Scholar

    Морено, П. Р., ван дер Хейден, Р., и Verpoorte, R. (1995). Клеточные и тканевые культуры Catharanthus roseus : обзор литературы. Завод. Клетка. Тисс. Орг. 42, 1–25. DOI: 10.1007 / BF00037677

    CrossRef Полный текст | Google Scholar

    Мурашиге Т. и Скуг Ф. (1962). Обновленная среда для быстрого роста и биологических анализов с культурой ткани табака. Physiol. Plantarum. 15, 473–497. DOI: 10.1111 / j.1399-3054.1962.tb08052.x

    CrossRef Полный текст | Google Scholar

    Окумото, С., Лугер, Л. Л., Мичева, К. Д., Реймер, Р. Дж., Смит, С. Дж., И Фроммер, В. Б. (2005). Обнаружение высвобождения глутамата из нейронов с помощью генетически закодированных нанонананосенсоров FRET с отображением на поверхности. Proc. Natl. Акад. Sci. США. 102, 8740–8745. DOI: 10.1073 / pnas.0503274102

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Шлатманн, Дж. Э., Нуутила, А. М., Ван Гулик, В. М., Тен Хупен, Х. Дж., Верпоорте, Р. и Дж. Хейнен, Дж. (1993). Масштабирование производства аджмалицина культурами растительных клеток Catharanthus roseus . Biotechnol. Bioeng. 41, 253–262 doi: 10.1002 / bit. 260410212

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ставринидес, А., Тацис, Э. К., Капути, Л., Фуро, Э., Стивенсон, К. Э., Лоусон, и др. (2016). Структурное исследование синтеза гетероохимбиновых алкалоидов выявило элементы активного центра, которые контролируют стереоселективность. Nat. Commun. 7: 12116. DOI: 10.1038 / ncomms12116

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    тен Хупен, H.J., van Gulik, W.M., Schlatmann, J.E., Moreno, P.R., Vinke, J.L., Heijnen, et al. (1994). Производство аджмалицина культурами клеток Catharanthus roseus : от встряхиваемой колбы до биореактора. Завод. Клетка. Тисс. Орг. 38, 85–91. DOI: 10.1007 / BF00033865

    CrossRef Полный текст | Google Scholar

    Уся Т., Ватабе Т., Кадота С. и Тезука Ю. (2005). Компоненты, ингибирующие цитохром P450 2D6 (CYP2D6) Catharanthus roseus . Biol.Pharm. Бык. 28, 1021–1024. DOI: 10.1248 / bpb.28.1021

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ван, А., Стаут, К. Д., Чжан, К., и Джонсон, Э. Ф. (2015). Вклад ионных взаимодействий и динамики белка в связывание субстрата и ингибитора цитохрома P450 2D6 (CYP2D6). J. Biol. Chem. 290, 5092–5104. DOI: 10.1074 / jbc.M114.627661

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Зафар, Н., Муджиб, А., Али, М., Тонк, Д., Гульзар, Б., Малик, М. и др. (2019). Анализ размера генома выращенного в полевых условиях и регенерированной культуры ткани Rauvolfia serpentina (L) с помощью проточной цитометрии: гистология и сканирующее электронно-микроскопическое исследование морфогенеза in vitro . Ind. Урожай. Prod. 128, 545–555. DOI: 10.1016 / j.indcrop.2018.11.049

    CrossRef Полный текст | Google Scholar

    Zheng, Z.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *